Incidental Mutation 'R5184:Nutm1'
ID397727
Institutional Source Beutler Lab
Gene Symbol Nutm1
Ensembl Gene ENSMUSG00000041358
Gene NameNUT midline carcinoma, family member 1
SynonymsBC125332, Nut
MMRRC Submission 042763-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5184 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location112247948-112259291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 112249000 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 857 (T857S)
Ref Sequence ENSEMBL: ENSMUSP00000048263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028554] [ENSMUST00000043970]
Predicted Effect probably benign
Transcript: ENSMUST00000028554
SMART Domains Protein: ENSMUSP00000028554
Gene: ENSMUSG00000027134

DomainStartEndE-ValueType
transmembrane domain 40 62 N/A INTRINSIC
low complexity region 92 113 N/A INTRINSIC
PlsC 123 234 5.73e-24 SMART
low complexity region 411 422 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000043970
AA Change: T857S

PolyPhen 2 Score 0.566 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000048263
Gene: ENSMUSG00000041358
AA Change: T857S

DomainStartEndE-ValueType
Pfam:NUT 14 541 1.4e-210 PFAM
low complexity region 840 854 N/A INTRINSIC
Pfam:NUT 900 1123 6.7e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136219
Meta Mutation Damage Score 0.1051 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aph1a T A 3: 95,895,739 probably null Het
Arid3a A G 10: 79,950,769 E452G possibly damaging Het
Barhl2 A G 5: 106,457,640 S68P unknown Het
BC030499 T C 11: 78,292,747 F194L probably benign Het
Carf T C 1: 60,108,174 S17P probably damaging Het
Ccdc90b A G 7: 92,574,811 D145G probably damaging Het
Cyp7a1 A T 4: 6,271,207 N316K probably benign Het
Daam2 A G 17: 49,494,391 I106T possibly damaging Het
Dmtf1 A G 5: 9,126,641 V437A probably benign Het
E2f2 A T 4: 136,184,440 Y254F possibly damaging Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Ern2 T C 7: 122,179,959 T221A probably benign Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fermt1 A G 2: 132,941,963 V42A possibly damaging Het
Fgf3 A G 7: 144,842,810 D187G probably damaging Het
Flnb T A 14: 7,901,945 V936E probably damaging Het
Gm5415 A T 1: 32,545,648 C394S probably damaging Het
Herc2 T C 7: 56,122,351 Y1093H probably damaging Het
Invs A G 4: 48,283,242 probably benign Het
Katnb1 T A 8: 95,097,980 I534N possibly damaging Het
Kcnq5 A T 1: 21,402,487 D826E probably damaging Het
Klra9 A T 6: 130,188,712 N113K probably benign Het
Knl1 A G 2: 119,069,176 K453E probably damaging Het
Lgi4 C T 7: 31,070,757 probably benign Het
Lpin3 A G 2: 160,897,138 S289G probably benign Het
Mapre1 T A 2: 153,758,067 V137E possibly damaging Het
Mark4 A G 7: 19,447,243 F144L possibly damaging Het
Mogat2 G T 7: 99,223,635 A114E possibly damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Nell2 A G 15: 95,527,809 L19P possibly damaging Het
Nfia A T 4: 97,783,348 K98N probably damaging Het
Olfr146 T A 9: 39,018,702 I280F probably damaging Het
Olfr298 TG T 7: 86,489,291 probably null Het
Olfr68 T C 7: 103,777,404 K314E probably benign Het
Pde10a T C 17: 8,977,155 L706P probably damaging Het
Penk A G 4: 4,134,296 L117P probably damaging Het
Pgap1 A G 1: 54,481,856 S876P probably damaging Het
Pmfbp1 T C 8: 109,527,767 I478T possibly damaging Het
Pole G A 5: 110,294,934 E318K possibly damaging Het
Prr12 C A 7: 45,046,377 V1222L unknown Het
Prune2 T C 19: 17,216,357 S3070P possibly damaging Het
Rnf19a A G 15: 36,244,196 C573R probably benign Het
Rp1l1 T C 14: 64,030,180 S1072P probably damaging Het
Sh3pxd2a T C 19: 47,273,411 N315S possibly damaging Het
Snph T C 2: 151,594,544 I86V probably damaging Het
Sox6 A G 7: 115,777,228 Y90H probably damaging Het
Tbc1d13 T A 2: 30,142,311 C145S probably benign Het
Tcp11l1 T C 2: 104,699,944 E65G probably damaging Het
Thrb G T 14: 18,011,181 E186* probably null Het
Tmem101 A G 11: 102,156,233 Y38H possibly damaging Het
Tusc5 T A 11: 76,680,308 L50Q probably damaging Het
Urb1 A T 16: 90,783,274 probably null Het
Usp10 G A 8: 119,956,681 V764I possibly damaging Het
Usp25 A G 16: 77,109,227 E857G probably benign Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Wdr35 T C 12: 9,018,142 L775P probably damaging Het
Xpnpep1 T C 19: 53,013,414 T134A probably benign Het
Zbtb10 T C 3: 9,264,671 V363A probably damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Other mutations in Nutm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01557:Nutm1 APN 2 112251818 missense probably benign 0.36
IGL02190:Nutm1 APN 2 112249406 nonsense probably null
IGL02546:Nutm1 APN 2 112248324 missense probably benign 0.00
IGL02888:Nutm1 APN 2 112250635 missense probably damaging 1.00
IGL03062:Nutm1 APN 2 112248933 missense probably benign 0.16
R1024:Nutm1 UTSW 2 112249929 missense probably benign 0.35
R1314:Nutm1 UTSW 2 112249809 missense probably benign 0.10
R2061:Nutm1 UTSW 2 112255752 nonsense probably null
R4092:Nutm1 UTSW 2 112249464 missense probably damaging 1.00
R4402:Nutm1 UTSW 2 112249809 missense probably damaging 0.99
R4783:Nutm1 UTSW 2 112248936 missense probably benign 0.00
R4784:Nutm1 UTSW 2 112248936 missense probably benign 0.00
R4785:Nutm1 UTSW 2 112248936 missense probably benign 0.00
R5662:Nutm1 UTSW 2 112249300 missense probably benign 0.01
R5922:Nutm1 UTSW 2 112249314 missense possibly damaging 0.93
R6053:Nutm1 UTSW 2 112249090 missense probably benign 0.01
R6344:Nutm1 UTSW 2 112248902 missense possibly damaging 0.91
R6410:Nutm1 UTSW 2 112248729 missense possibly damaging 0.75
R6515:Nutm1 UTSW 2 112256320 missense probably benign 0.01
R6516:Nutm1 UTSW 2 112251217 missense probably damaging 1.00
R6573:Nutm1 UTSW 2 112251043 critical splice donor site probably null
R6950:Nutm1 UTSW 2 112248559 missense probably benign 0.00
R6975:Nutm1 UTSW 2 112256218 missense probably damaging 1.00
R7033:Nutm1 UTSW 2 112256168 missense probably damaging 1.00
R7070:Nutm1 UTSW 2 112249461 missense probably benign
R7072:Nutm1 UTSW 2 112251847 missense probably benign 0.34
R7140:Nutm1 UTSW 2 112250056 missense probably damaging 0.98
R7143:Nutm1 UTSW 2 112250056 missense probably damaging 0.98
R7294:Nutm1 UTSW 2 112250056 missense probably damaging 0.98
R7296:Nutm1 UTSW 2 112250056 missense probably damaging 0.98
R7297:Nutm1 UTSW 2 112250056 missense probably damaging 0.98
R7613:Nutm1 UTSW 2 112249239 missense probably benign 0.00
X0065:Nutm1 UTSW 2 112248627 missense probably damaging 1.00
X0066:Nutm1 UTSW 2 112248357 missense probably damaging 1.00
Z1177:Nutm1 UTSW 2 112255716 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGGCAACTGTCATCTTTAAC -3'
(R):5'- TGGGGAACAGTGTGATTCCC -3'

Sequencing Primer
(F):5'- GGGCAACTGTCATCTTTAACATCTAG -3'
(R):5'- AACAGTGTGATTCCCTCTGGAG -3'
Posted On2016-07-06