Incidental Mutation 'R5184:Mapre1'
ID397732
Institutional Source Beutler Lab
Gene Symbol Mapre1
Ensembl Gene ENSMUSG00000027479
Gene Namemicrotubule-associated protein, RP/EB family, member 1
SynonymsEb1, 5530600P05Rik, BIM1p, D2Ertd459e
MMRRC Submission 042763-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.591) question?
Stock #R5184 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location153741274-153773310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 153758067 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 137 (V137E)
Ref Sequence ENSEMBL: ENSMUSP00000028981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028981]
PDB Structure
Solution structure of the CH domain from mouse EB-1 [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028981
AA Change: V137E

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000028981
Gene: ENSMUSG00000027479
AA Change: V137E

DomainStartEndE-ValueType
Pfam:CH 14 114 5.2e-11 PFAM
Pfam:EB1 210 248 1.2e-20 PFAM
low complexity region 256 267 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123570
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123795
Meta Mutation Damage Score 0.1067 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was first identified by its binding to the APC protein which is often mutated in familial and sporadic forms of colorectal cancer. This protein localizes to microtubules, especially the growing ends, in interphase cells. During mitosis, the protein is associated with the centrosomes and spindle microtubules. The protein also associates with components of the dynactin complex and the intermediate chain of cytoplasmic dynein. Because of these associations, it is thought that this protein is involved in the regulation of microtubule structures and chromosome stability. This gene is a member of the RP/EB family. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aph1a T A 3: 95,895,739 probably null Het
Arid3a A G 10: 79,950,769 E452G possibly damaging Het
Barhl2 A G 5: 106,457,640 S68P unknown Het
BC030499 T C 11: 78,292,747 F194L probably benign Het
Carf T C 1: 60,108,174 S17P probably damaging Het
Ccdc90b A G 7: 92,574,811 D145G probably damaging Het
Cyp7a1 A T 4: 6,271,207 N316K probably benign Het
Daam2 A G 17: 49,494,391 I106T possibly damaging Het
Dmtf1 A G 5: 9,126,641 V437A probably benign Het
E2f2 A T 4: 136,184,440 Y254F possibly damaging Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Ern2 T C 7: 122,179,959 T221A probably benign Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fermt1 A G 2: 132,941,963 V42A possibly damaging Het
Fgf3 A G 7: 144,842,810 D187G probably damaging Het
Flnb T A 14: 7,901,945 V936E probably damaging Het
Gm5415 A T 1: 32,545,648 C394S probably damaging Het
Herc2 T C 7: 56,122,351 Y1093H probably damaging Het
Invs A G 4: 48,283,242 probably benign Het
Katnb1 T A 8: 95,097,980 I534N possibly damaging Het
Kcnq5 A T 1: 21,402,487 D826E probably damaging Het
Klra9 A T 6: 130,188,712 N113K probably benign Het
Knl1 A G 2: 119,069,176 K453E probably damaging Het
Lgi4 C T 7: 31,070,757 probably benign Het
Lpin3 A G 2: 160,897,138 S289G probably benign Het
Mark4 A G 7: 19,447,243 F144L possibly damaging Het
Mogat2 G T 7: 99,223,635 A114E possibly damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Nell2 A G 15: 95,527,809 L19P possibly damaging Het
Nfia A T 4: 97,783,348 K98N probably damaging Het
Nutm1 T A 2: 112,249,000 T857S possibly damaging Het
Olfr146 T A 9: 39,018,702 I280F probably damaging Het
Olfr298 TG T 7: 86,489,291 probably null Het
Olfr68 T C 7: 103,777,404 K314E probably benign Het
Pde10a T C 17: 8,977,155 L706P probably damaging Het
Penk A G 4: 4,134,296 L117P probably damaging Het
Pgap1 A G 1: 54,481,856 S876P probably damaging Het
Pmfbp1 T C 8: 109,527,767 I478T possibly damaging Het
Pole G A 5: 110,294,934 E318K possibly damaging Het
Prr12 C A 7: 45,046,377 V1222L unknown Het
Prune2 T C 19: 17,216,357 S3070P possibly damaging Het
Rnf19a A G 15: 36,244,196 C573R probably benign Het
Rp1l1 T C 14: 64,030,180 S1072P probably damaging Het
Sh3pxd2a T C 19: 47,273,411 N315S possibly damaging Het
Snph T C 2: 151,594,544 I86V probably damaging Het
Sox6 A G 7: 115,777,228 Y90H probably damaging Het
Tbc1d13 T A 2: 30,142,311 C145S probably benign Het
Tcp11l1 T C 2: 104,699,944 E65G probably damaging Het
Thrb G T 14: 18,011,181 E186* probably null Het
Tmem101 A G 11: 102,156,233 Y38H possibly damaging Het
Tusc5 T A 11: 76,680,308 L50Q probably damaging Het
Urb1 A T 16: 90,783,274 probably null Het
Usp10 G A 8: 119,956,681 V764I possibly damaging Het
Usp25 A G 16: 77,109,227 E857G probably benign Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Wdr35 T C 12: 9,018,142 L775P probably damaging Het
Xpnpep1 T C 19: 53,013,414 T134A probably benign Het
Zbtb10 T C 3: 9,264,671 V363A probably damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Other mutations in Mapre1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00795:Mapre1 APN 2 153746314 missense probably damaging 1.00
R1157:Mapre1 UTSW 2 153758017 missense probably benign 0.04
R3877:Mapre1 UTSW 2 153746281 missense possibly damaging 0.95
R7133:Mapre1 UTSW 2 153764963 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TGCAAACTGATCTTAGCAACCC -3'
(R):5'- GCCGCAGCATAACCCATATG -3'

Sequencing Primer
(F):5'- ACAGGTTTGATGTTTGCCAAAGC -3'
(R):5'- TAACCCATATGGAGCACCTATG -3'
Posted On2016-07-06