Incidental Mutation 'R5184:Aph1a'
ID397735
Institutional Source Beutler Lab
Gene Symbol Aph1a
Ensembl Gene ENSMUSG00000015750
Gene Nameaph1 homolog A, gamma secretase subunit
Synonyms6530402N02Rik
MMRRC Submission 042763-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5184 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location95893969-95898288 bp(+) (GRCm38)
Type of Mutationunclassified (2029 bp from exon)
DNA Base Change (assembly) T to A at 95895739 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015894] [ENSMUST00000036181] [ENSMUST00000036360] [ENSMUST00000056710] [ENSMUST00000090476] [ENSMUST00000147962] [ENSMUST00000171519] [ENSMUST00000197081]
PDB Structure
Crystal Structure of the Extracellular Domain of Murine Carbonic Anhydrase XIV [X-RAY DIFFRACTION]
Crystal Structure of the Extracellular Domain of Murine Carbonic Anhydrase XIV in Complex with Acetazolamide [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000015894
AA Change: I168N

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000015894
Gene: ENSMUSG00000015750
AA Change: I168N

DomainStartEndE-ValueType
Pfam:Aph-1 2 246 7.3e-98 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000036181
SMART Domains Protein: ENSMUSP00000036983
Gene: ENSMUSG00000038526

DomainStartEndE-ValueType
Carb_anhydrase 22 278 2.43e-123 SMART
transmembrane domain 290 312 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036360
SMART Domains Protein: ENSMUSP00000046810
Gene: ENSMUSG00000038543

DomainStartEndE-ValueType
Pfam:DUF4634 1 145 3.6e-64 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000056710
AA Change: I168N

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000058846
Gene: ENSMUSG00000015750
AA Change: I168N

DomainStartEndE-ValueType
Pfam:Aph-1 2 239 1.2e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090476
SMART Domains Protein: ENSMUSP00000102749
Gene: ENSMUSG00000038543

DomainStartEndE-ValueType
Pfam:DUF4634 1 146 1.8e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145949
Predicted Effect probably benign
Transcript: ENSMUST00000147962
SMART Domains Protein: ENSMUSP00000117464
Gene: ENSMUSG00000038526

DomainStartEndE-ValueType
Carb_anhydrase 8 171 1.79e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171519
SMART Domains Protein: ENSMUSP00000127666
Gene: ENSMUSG00000038543

DomainStartEndE-ValueType
Pfam:DUF4634 1 146 1.5e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197232
Meta Mutation Damage Score 0.5728 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: This gene encodes a subunit of the gamma-secretase complex, which is localized to the endoplasmic reticulum and golgi apparatus. Gamma-secretase is a multi-protein enzyme that catalyzes intramembraneous proteolysis of type I transmembrane proteins and is essential for many signaling pathways, including the Notch signaling pathway. Studies suggest that the protein encoded by this locus binds directly to substrates of the gamma-secretase complex, including the beta-amyloid precursor protein which is associated with Alzheimer disease progression. This gene is required for normal embryonic development and survival, and disruption is associated with defects in the yolk sack angiogenesis, neural tube formation, and somitogenesis. A pseudogene of this gene is located on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous null embryos die by E11, are severely growth retarded by E9.5 and display defects in somite patterning, branchial arch and heart chamber development, vascular morphogenesis of the yolk sac and have distended pericardial sacs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid3a A G 10: 79,950,769 E452G possibly damaging Het
Barhl2 A G 5: 106,457,640 S68P unknown Het
BC030499 T C 11: 78,292,747 F194L probably benign Het
Carf T C 1: 60,108,174 S17P probably damaging Het
Ccdc90b A G 7: 92,574,811 D145G probably damaging Het
Cyp7a1 A T 4: 6,271,207 N316K probably benign Het
Daam2 A G 17: 49,494,391 I106T possibly damaging Het
Dmtf1 A G 5: 9,126,641 V437A probably benign Het
E2f2 A T 4: 136,184,440 Y254F possibly damaging Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Ern2 T C 7: 122,179,959 T221A probably benign Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fermt1 A G 2: 132,941,963 V42A possibly damaging Het
Fgf3 A G 7: 144,842,810 D187G probably damaging Het
Flnb T A 14: 7,901,945 V936E probably damaging Het
Gm5415 A T 1: 32,545,648 C394S probably damaging Het
Herc2 T C 7: 56,122,351 Y1093H probably damaging Het
Invs A G 4: 48,283,242 probably benign Het
Katnb1 T A 8: 95,097,980 I534N possibly damaging Het
Kcnq5 A T 1: 21,402,487 D826E probably damaging Het
Klra9 A T 6: 130,188,712 N113K probably benign Het
Knl1 A G 2: 119,069,176 K453E probably damaging Het
Lgi4 C T 7: 31,070,757 probably benign Het
Lpin3 A G 2: 160,897,138 S289G probably benign Het
Mapre1 T A 2: 153,758,067 V137E possibly damaging Het
Mark4 A G 7: 19,447,243 F144L possibly damaging Het
Mogat2 G T 7: 99,223,635 A114E possibly damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Nell2 A G 15: 95,527,809 L19P possibly damaging Het
Nfia A T 4: 97,783,348 K98N probably damaging Het
Nutm1 T A 2: 112,249,000 T857S possibly damaging Het
Olfr146 T A 9: 39,018,702 I280F probably damaging Het
Olfr298 TG T 7: 86,489,291 probably null Het
Olfr68 T C 7: 103,777,404 K314E probably benign Het
Pde10a T C 17: 8,977,155 L706P probably damaging Het
Penk A G 4: 4,134,296 L117P probably damaging Het
Pgap1 A G 1: 54,481,856 S876P probably damaging Het
Pmfbp1 T C 8: 109,527,767 I478T possibly damaging Het
Pole G A 5: 110,294,934 E318K possibly damaging Het
Prr12 C A 7: 45,046,377 V1222L unknown Het
Prune2 T C 19: 17,216,357 S3070P possibly damaging Het
Rnf19a A G 15: 36,244,196 C573R probably benign Het
Rp1l1 T C 14: 64,030,180 S1072P probably damaging Het
Sh3pxd2a T C 19: 47,273,411 N315S possibly damaging Het
Snph T C 2: 151,594,544 I86V probably damaging Het
Sox6 A G 7: 115,777,228 Y90H probably damaging Het
Tbc1d13 T A 2: 30,142,311 C145S probably benign Het
Tcp11l1 T C 2: 104,699,944 E65G probably damaging Het
Thrb G T 14: 18,011,181 E186* probably null Het
Tmem101 A G 11: 102,156,233 Y38H possibly damaging Het
Tusc5 T A 11: 76,680,308 L50Q probably damaging Het
Urb1 A T 16: 90,783,274 probably null Het
Usp10 G A 8: 119,956,681 V764I possibly damaging Het
Usp25 A G 16: 77,109,227 E857G probably benign Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Wdr35 T C 12: 9,018,142 L775P probably damaging Het
Xpnpep1 T C 19: 53,013,414 T134A probably benign Het
Zbtb10 T C 3: 9,264,671 V363A probably damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Other mutations in Aph1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02103:Aph1a APN 3 95895813 missense probably damaging 0.99
R1675:Aph1a UTSW 3 95894899 missense possibly damaging 0.96
R1735:Aph1a UTSW 3 95895509 missense probably damaging 1.00
R1872:Aph1a UTSW 3 95895564 missense probably damaging 1.00
R2356:Aph1a UTSW 3 95894232 missense probably benign 0.24
R3942:Aph1a UTSW 3 95894261 missense probably damaging 1.00
R4654:Aph1a UTSW 3 95895776 missense probably benign 0.01
R4989:Aph1a UTSW 3 95895531 missense probably damaging 1.00
R5134:Aph1a UTSW 3 95895531 missense probably damaging 1.00
R6603:Aph1a UTSW 3 95895496 missense probably damaging 1.00
R6650:Aph1a UTSW 3 95896286 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- CAGGTAAGGCCCACTTCTAACC -3'
(R):5'- AGAAGTCAAGATTCTGCCTCCG -3'

Sequencing Primer
(F):5'- AAGGCCCACTTCTAACCTTGCC -3'
(R):5'- GGTGACTTACTAGGTGGGAAC -3'
Posted On2016-07-06