Incidental Mutation 'R5184:Cyp7a1'
ID397737
Institutional Source Beutler Lab
Gene Symbol Cyp7a1
Ensembl Gene ENSMUSG00000028240
Gene Namecytochrome P450, family 7, subfamily a, polypeptide 1
Synonymscholesterol 7 alpha hydroxylase
MMRRC Submission 042763-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.293) question?
Stock #R5184 (G1)
Quality Score193
Status Validated
Chromosome4
Chromosomal Location6265612-6275633 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 6271207 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 316 (N316K)
Ref Sequence ENSEMBL: ENSMUSP00000029905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029905]
Predicted Effect probably benign
Transcript: ENSMUST00000029905
AA Change: N316K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029905
Gene: ENSMUSG00000028240
AA Change: N316K

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:p450 32 497 2.3e-87 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147346
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum membrane protein catalyzes the first reaction in the cholesterol catabolic pathway in the liver, which converts cholesterol to bile acids. This reaction is the rate limiting step and the major site of regulation of bile acid synthesis, which is the primary mechanism for the removal of cholesterol from the body. Polymorphisms in the promoter of this gene are associated with defects in bile acid synthesis. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for disruption of this gene experience severe neonatal and postnatal lethality. Supplementation of the maternal diet with fat soluble vitamins and cholic acid starting before birth alleviates much of the phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aph1a T A 3: 95,895,739 probably null Het
Arid3a A G 10: 79,950,769 E452G possibly damaging Het
Barhl2 A G 5: 106,457,640 S68P unknown Het
BC030499 T C 11: 78,292,747 F194L probably benign Het
Carf T C 1: 60,108,174 S17P probably damaging Het
Ccdc90b A G 7: 92,574,811 D145G probably damaging Het
Daam2 A G 17: 49,494,391 I106T possibly damaging Het
Dmtf1 A G 5: 9,126,641 V437A probably benign Het
E2f2 A T 4: 136,184,440 Y254F possibly damaging Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Ern2 T C 7: 122,179,959 T221A probably benign Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fermt1 A G 2: 132,941,963 V42A possibly damaging Het
Fgf3 A G 7: 144,842,810 D187G probably damaging Het
Flnb T A 14: 7,901,945 V936E probably damaging Het
Gm5415 A T 1: 32,545,648 C394S probably damaging Het
Herc2 T C 7: 56,122,351 Y1093H probably damaging Het
Invs A G 4: 48,283,242 probably benign Het
Katnb1 T A 8: 95,097,980 I534N possibly damaging Het
Kcnq5 A T 1: 21,402,487 D826E probably damaging Het
Klra9 A T 6: 130,188,712 N113K probably benign Het
Knl1 A G 2: 119,069,176 K453E probably damaging Het
Lgi4 C T 7: 31,070,757 probably benign Het
Lpin3 A G 2: 160,897,138 S289G probably benign Het
Mapre1 T A 2: 153,758,067 V137E possibly damaging Het
Mark4 A G 7: 19,447,243 F144L possibly damaging Het
Mogat2 G T 7: 99,223,635 A114E possibly damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Nell2 A G 15: 95,527,809 L19P possibly damaging Het
Nfia A T 4: 97,783,348 K98N probably damaging Het
Nutm1 T A 2: 112,249,000 T857S possibly damaging Het
Olfr146 T A 9: 39,018,702 I280F probably damaging Het
Olfr298 TG T 7: 86,489,291 probably null Het
Olfr68 T C 7: 103,777,404 K314E probably benign Het
Pde10a T C 17: 8,977,155 L706P probably damaging Het
Penk A G 4: 4,134,296 L117P probably damaging Het
Pgap1 A G 1: 54,481,856 S876P probably damaging Het
Pmfbp1 T C 8: 109,527,767 I478T possibly damaging Het
Pole G A 5: 110,294,934 E318K possibly damaging Het
Prr12 C A 7: 45,046,377 V1222L unknown Het
Prune2 T C 19: 17,216,357 S3070P possibly damaging Het
Rnf19a A G 15: 36,244,196 C573R probably benign Het
Rp1l1 T C 14: 64,030,180 S1072P probably damaging Het
Sh3pxd2a T C 19: 47,273,411 N315S possibly damaging Het
Snph T C 2: 151,594,544 I86V probably damaging Het
Sox6 A G 7: 115,777,228 Y90H probably damaging Het
Tbc1d13 T A 2: 30,142,311 C145S probably benign Het
Tcp11l1 T C 2: 104,699,944 E65G probably damaging Het
Thrb G T 14: 18,011,181 E186* probably null Het
Tmem101 A G 11: 102,156,233 Y38H possibly damaging Het
Tusc5 T A 11: 76,680,308 L50Q probably damaging Het
Urb1 A T 16: 90,783,274 probably null Het
Usp10 G A 8: 119,956,681 V764I possibly damaging Het
Usp25 A G 16: 77,109,227 E857G probably benign Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Wdr35 T C 12: 9,018,142 L775P probably damaging Het
Xpnpep1 T C 19: 53,013,414 T134A probably benign Het
Zbtb10 T C 3: 9,264,671 V363A probably damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Other mutations in Cyp7a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01298:Cyp7a1 APN 4 6275517 missense probably damaging 1.00
IGL01577:Cyp7a1 APN 4 6273618 missense probably damaging 1.00
IGL01723:Cyp7a1 APN 4 6272442 missense probably damaging 1.00
IGL02602:Cyp7a1 APN 4 6272871 missense possibly damaging 0.88
IGL03302:Cyp7a1 APN 4 6273801 missense probably benign 0.05
R1017:Cyp7a1 UTSW 4 6272307 missense probably damaging 1.00
R1737:Cyp7a1 UTSW 4 6272848 missense probably benign 0.00
R2044:Cyp7a1 UTSW 4 6275492 missense probably null 1.00
R2326:Cyp7a1 UTSW 4 6268396 missense probably benign
R2867:Cyp7a1 UTSW 4 6272493 missense probably damaging 0.99
R2867:Cyp7a1 UTSW 4 6272493 missense probably damaging 0.99
R3438:Cyp7a1 UTSW 4 6272769 missense probably damaging 1.00
R4181:Cyp7a1 UTSW 4 6271205 missense probably benign 0.09
R4844:Cyp7a1 UTSW 4 6273655 missense probably damaging 1.00
R5371:Cyp7a1 UTSW 4 6268378 missense probably damaging 1.00
R5613:Cyp7a1 UTSW 4 6272799 missense probably damaging 1.00
R5682:Cyp7a1 UTSW 4 6268429 missense probably benign 0.28
R5987:Cyp7a1 UTSW 4 6268476 missense probably benign 0.05
R5995:Cyp7a1 UTSW 4 6272371 missense possibly damaging 0.74
R6128:Cyp7a1 UTSW 4 6272788 missense possibly damaging 0.80
R6552:Cyp7a1 UTSW 4 6272361 nonsense probably null
R6860:Cyp7a1 UTSW 4 6272587 missense probably damaging 1.00
R7032:Cyp7a1 UTSW 4 6268463 missense possibly damaging 0.94
R7631:Cyp7a1 UTSW 4 6272763 missense possibly damaging 0.89
R7884:Cyp7a1 UTSW 4 6272697 missense probably benign 0.04
R7967:Cyp7a1 UTSW 4 6272697 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GGTAGACACGAATGAAAATGTCCC -3'
(R):5'- CACACTCCCTGGTACCATGATC -3'

Sequencing Primer
(F):5'- CAGGTGCTACATACTTGGCTTAACG -3'
(R):5'- CTTACTTGCTCGCAGATC -3'
Posted On2016-07-06