Incidental Mutation 'R5184:Pole'
ID397744
Institutional Source Beutler Lab
Gene Symbol Pole
Ensembl Gene ENSMUSG00000007080
Gene Namepolymerase (DNA directed), epsilon
Synonymspol-epsilon
MMRRC Submission 042763-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5184 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location110286306-110337474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 110294934 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 318 (E318K)
Ref Sequence ENSEMBL: ENSMUSP00000007296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007296] [ENSMUST00000112482]
Predicted Effect possibly damaging
Transcript: ENSMUST00000007296
AA Change: E318K

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000007296
Gene: ENSMUSG00000007080
AA Change: E318K

DomainStartEndE-ValueType
POLBc 267 870 9.42e-97 SMART
Blast:POLBc 903 970 1e-28 BLAST
Blast:POLBc 1014 1073 2e-22 BLAST
Blast:POLBc 1195 1266 7e-21 BLAST
low complexity region 1275 1294 N/A INTRINSIC
Blast:DUF1744 1401 1430 2e-7 BLAST
DUF1744 1524 1924 1.9e-236 SMART
coiled coil region 1936 1963 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112482
SMART Domains Protein: ENSMUSP00000108101
Gene: ENSMUSG00000007080

DomainStartEndE-ValueType
Pfam:DNA_pol_B_exo1 86 190 1.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131887
Meta Mutation Damage Score 0.2027 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of DNA polymerase epsilon. The enzyme is involved in DNA repair and chromosomal DNA replication. Mutations in this gene have been associated with colorectal cancer 12 and facial dysmorphism, immunodeficiency, livedo, and short stature. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit increased incidence of tumors and premature death. Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aph1a T A 3: 95,895,739 probably null Het
Arid3a A G 10: 79,950,769 E452G possibly damaging Het
Barhl2 A G 5: 106,457,640 S68P unknown Het
BC030499 T C 11: 78,292,747 F194L probably benign Het
Carf T C 1: 60,108,174 S17P probably damaging Het
Ccdc90b A G 7: 92,574,811 D145G probably damaging Het
Cyp7a1 A T 4: 6,271,207 N316K probably benign Het
Daam2 A G 17: 49,494,391 I106T possibly damaging Het
Dmtf1 A G 5: 9,126,641 V437A probably benign Het
E2f2 A T 4: 136,184,440 Y254F possibly damaging Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Ern2 T C 7: 122,179,959 T221A probably benign Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fermt1 A G 2: 132,941,963 V42A possibly damaging Het
Fgf3 A G 7: 144,842,810 D187G probably damaging Het
Flnb T A 14: 7,901,945 V936E probably damaging Het
Gm5415 A T 1: 32,545,648 C394S probably damaging Het
Herc2 T C 7: 56,122,351 Y1093H probably damaging Het
Invs A G 4: 48,283,242 probably benign Het
Katnb1 T A 8: 95,097,980 I534N possibly damaging Het
Kcnq5 A T 1: 21,402,487 D826E probably damaging Het
Klra9 A T 6: 130,188,712 N113K probably benign Het
Knl1 A G 2: 119,069,176 K453E probably damaging Het
Lgi4 C T 7: 31,070,757 probably benign Het
Lpin3 A G 2: 160,897,138 S289G probably benign Het
Mapre1 T A 2: 153,758,067 V137E possibly damaging Het
Mark4 A G 7: 19,447,243 F144L possibly damaging Het
Mogat2 G T 7: 99,223,635 A114E possibly damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Nell2 A G 15: 95,527,809 L19P possibly damaging Het
Nfia A T 4: 97,783,348 K98N probably damaging Het
Nutm1 T A 2: 112,249,000 T857S possibly damaging Het
Olfr146 T A 9: 39,018,702 I280F probably damaging Het
Olfr298 TG T 7: 86,489,291 probably null Het
Olfr68 T C 7: 103,777,404 K314E probably benign Het
Pde10a T C 17: 8,977,155 L706P probably damaging Het
Penk A G 4: 4,134,296 L117P probably damaging Het
Pgap1 A G 1: 54,481,856 S876P probably damaging Het
Pmfbp1 T C 8: 109,527,767 I478T possibly damaging Het
Prr12 C A 7: 45,046,377 V1222L unknown Het
Prune2 T C 19: 17,216,357 S3070P possibly damaging Het
Rnf19a A G 15: 36,244,196 C573R probably benign Het
Rp1l1 T C 14: 64,030,180 S1072P probably damaging Het
Sh3pxd2a T C 19: 47,273,411 N315S possibly damaging Het
Snph T C 2: 151,594,544 I86V probably damaging Het
Sox6 A G 7: 115,777,228 Y90H probably damaging Het
Tbc1d13 T A 2: 30,142,311 C145S probably benign Het
Tcp11l1 T C 2: 104,699,944 E65G probably damaging Het
Thrb G T 14: 18,011,181 E186* probably null Het
Tmem101 A G 11: 102,156,233 Y38H possibly damaging Het
Tusc5 T A 11: 76,680,308 L50Q probably damaging Het
Urb1 A T 16: 90,783,274 probably null Het
Usp10 G A 8: 119,956,681 V764I possibly damaging Het
Usp25 A G 16: 77,109,227 E857G probably benign Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Wdr35 T C 12: 9,018,142 L775P probably damaging Het
Xpnpep1 T C 19: 53,013,414 T134A probably benign Het
Zbtb10 T C 3: 9,264,671 V363A probably damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Other mutations in Pole
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Pole APN 5 110303565 splice site probably benign
IGL00475:Pole APN 5 110291096 nonsense probably null
IGL00837:Pole APN 5 110302009 missense possibly damaging 0.91
IGL00976:Pole APN 5 110323572 missense probably benign 0.00
IGL01081:Pole APN 5 110337240 missense possibly damaging 0.92
IGL01503:Pole APN 5 110303884 missense probably damaging 1.00
IGL01640:Pole APN 5 110298266 missense probably null 0.08
IGL01987:Pole APN 5 110337232 missense probably benign 0.01
IGL02429:Pole APN 5 110299800 missense probably benign
IGL02733:Pole APN 5 110312728 splice site probably benign
IGL03102:Pole APN 5 110297073 missense probably damaging 1.00
IGL03157:Pole APN 5 110293753 missense probably benign
IGL03186:Pole APN 5 110299920 critical splice donor site probably null
IGL03271:Pole APN 5 110318319 missense probably benign
IGL03351:Pole APN 5 110301998 splice site probably benign
IGL03408:Pole APN 5 110294560 missense probably damaging 1.00
IGL03410:Pole APN 5 110324559 missense probably benign
ANU74:Pole UTSW 5 110289370 missense probably benign 0.44
PIT4495001:Pole UTSW 5 110303914 missense probably damaging 1.00
R0053:Pole UTSW 5 110293340 missense probably damaging 1.00
R0053:Pole UTSW 5 110293340 missense probably damaging 1.00
R0124:Pole UTSW 5 110303992 missense probably damaging 0.96
R0145:Pole UTSW 5 110324425 missense probably damaging 0.99
R0523:Pole UTSW 5 110303593 missense probably damaging 0.96
R0590:Pole UTSW 5 110317926 missense probably benign
R0625:Pole UTSW 5 110325550 missense possibly damaging 0.50
R0707:Pole UTSW 5 110298988 missense probably damaging 1.00
R1160:Pole UTSW 5 110295253 missense possibly damaging 0.85
R1320:Pole UTSW 5 110309129 frame shift probably null
R1384:Pole UTSW 5 110323664 missense possibly damaging 0.81
R1626:Pole UTSW 5 110293369 missense probably benign 0.25
R1643:Pole UTSW 5 110317845 missense probably damaging 1.00
R1655:Pole UTSW 5 110335922 missense probably damaging 1.00
R1668:Pole UTSW 5 110297369 missense probably damaging 1.00
R1783:Pole UTSW 5 110297430 missense probably damaging 1.00
R1843:Pole UTSW 5 110330835 critical splice donor site probably null
R1853:Pole UTSW 5 110306853 missense possibly damaging 0.95
R1867:Pole UTSW 5 110334197 missense probably benign 0.08
R1874:Pole UTSW 5 110323664 missense possibly damaging 0.81
R1891:Pole UTSW 5 110332542 missense probably damaging 1.00
R1928:Pole UTSW 5 110327778 missense probably benign
R2073:Pole UTSW 5 110325551 missense probably damaging 0.99
R2341:Pole UTSW 5 110330963 missense possibly damaging 0.67
R2448:Pole UTSW 5 110297092 missense probably damaging 1.00
R2504:Pole UTSW 5 110290502 splice site probably null
R3053:Pole UTSW 5 110289795 missense probably damaging 1.00
R3892:Pole UTSW 5 110336439 missense probably damaging 1.00
R3964:Pole UTSW 5 110312782 missense probably damaging 1.00
R3965:Pole UTSW 5 110312782 missense probably damaging 1.00
R4374:Pole UTSW 5 110337205 missense possibly damaging 0.89
R4376:Pole UTSW 5 110337205 missense possibly damaging 0.89
R4377:Pole UTSW 5 110337205 missense possibly damaging 0.89
R4520:Pole UTSW 5 110297924 missense probably damaging 1.00
R4670:Pole UTSW 5 110306387 missense probably benign 0.01
R4778:Pole UTSW 5 110330832 missense probably benign 0.00
R4887:Pole UTSW 5 110324753 missense probably damaging 0.99
R4898:Pole UTSW 5 110290224 critical splice acceptor site probably null
R5359:Pole UTSW 5 110332488 missense probably benign 0.03
R5483:Pole UTSW 5 110294568 missense probably damaging 1.00
R5529:Pole UTSW 5 110332466 missense probably benign 0.20
R5576:Pole UTSW 5 110312065 nonsense probably null
R5817:Pole UTSW 5 110312972 missense probably damaging 1.00
R5877:Pole UTSW 5 110332463 missense probably benign
R5956:Pole UTSW 5 110337287 unclassified probably benign
R5990:Pole UTSW 5 110302144 missense probably damaging 1.00
R6019:Pole UTSW 5 110324514 missense probably benign 0.01
R6019:Pole UTSW 5 110324515 missense probably benign 0.01
R6093:Pole UTSW 5 110312090 missense probably benign 0.01
R6376:Pole UTSW 5 110336374 missense probably damaging 0.99
R6494:Pole UTSW 5 110324722 missense possibly damaging 0.86
R6535:Pole UTSW 5 110324807 missense probably damaging 1.00
R6723:Pole UTSW 5 110323616 missense probably benign 0.11
R6757:Pole UTSW 5 110303610 missense probably damaging 1.00
R6930:Pole UTSW 5 110293290 missense probably benign 0.01
R6988:Pole UTSW 5 110329583 missense probably damaging 0.97
R6992:Pole UTSW 5 110332499 missense probably damaging 0.99
R7067:Pole UTSW 5 110334218 missense probably damaging 1.00
R7097:Pole UTSW 5 110325102 synonymous probably null
R7122:Pole UTSW 5 110325102 synonymous probably null
R7202:Pole UTSW 5 110297107 missense possibly damaging 0.94
R7340:Pole UTSW 5 110334464 missense probably benign 0.06
R7345:Pole UTSW 5 110303903 missense possibly damaging 0.82
R7509:Pole UTSW 5 110330705 start gained probably benign
R7557:Pole UTSW 5 110312994 missense probably damaging 1.00
R7740:Pole UTSW 5 110331041 missense probably benign 0.00
R7792:Pole UTSW 5 110297466 splice site probably null
R7832:Pole UTSW 5 110317797 missense probably benign 0.00
R7849:Pole UTSW 5 110332548 missense probably benign 0.04
R7852:Pole UTSW 5 110306829 missense probably damaging 1.00
R7915:Pole UTSW 5 110317797 missense probably benign 0.00
R7932:Pole UTSW 5 110332548 missense probably benign 0.04
R7935:Pole UTSW 5 110306829 missense probably damaging 1.00
R8001:Pole UTSW 5 110312734 missense probably damaging 1.00
X0064:Pole UTSW 5 110317904 nonsense probably null
Y5377:Pole UTSW 5 110294891 critical splice acceptor site probably null
Y5380:Pole UTSW 5 110294891 critical splice acceptor site probably null
Z1088:Pole UTSW 5 110327865 missense possibly damaging 0.66
Z1177:Pole UTSW 5 110297009 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCCAGGTGAACAGAATC -3'
(R):5'- TTAGAAGCAGCAGCCTCTGTC -3'

Sequencing Primer
(F):5'- CCAGGTGAACAGAATCTCTTTTTGG -3'
(R):5'- AGCCTCTGTCAGCCCAGATG -3'
Posted On2016-07-06