Incidental Mutation 'R5184:Klra9'
ID397747
Institutional Source Beutler Lab
Gene Symbol Klra9
Ensembl Gene ENSMUSG00000033024
Gene Namekiller cell lectin-like receptor subfamily A, member 9
SynonymsLY49I1, Ly49I
MMRRC Submission 042763-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R5184 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location130178675-130193112 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 130188712 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 113 (N113K)
Ref Sequence ENSEMBL: ENSMUSP00000107663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071554] [ENSMUST00000112032]
Predicted Effect probably benign
Transcript: ENSMUST00000071554
AA Change: N113K

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000071485
Gene: ENSMUSG00000033024
AA Change: N113K

DomainStartEndE-ValueType
Blast:CLECT 73 116 4e-9 BLAST
CLECT 143 258 1.55e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112032
AA Change: N113K

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000107663
Gene: ENSMUSG00000033024
AA Change: N113K

DomainStartEndE-ValueType
Blast:CLECT 73 116 4e-9 BLAST
CLECT 143 258 1.55e-16 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aph1a T A 3: 95,895,739 probably null Het
Arid3a A G 10: 79,950,769 E452G possibly damaging Het
Barhl2 A G 5: 106,457,640 S68P unknown Het
BC030499 T C 11: 78,292,747 F194L probably benign Het
Carf T C 1: 60,108,174 S17P probably damaging Het
Ccdc90b A G 7: 92,574,811 D145G probably damaging Het
Cyp7a1 A T 4: 6,271,207 N316K probably benign Het
Daam2 A G 17: 49,494,391 I106T possibly damaging Het
Dmtf1 A G 5: 9,126,641 V437A probably benign Het
E2f2 A T 4: 136,184,440 Y254F possibly damaging Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Ern2 T C 7: 122,179,959 T221A probably benign Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fermt1 A G 2: 132,941,963 V42A possibly damaging Het
Fgf3 A G 7: 144,842,810 D187G probably damaging Het
Flnb T A 14: 7,901,945 V936E probably damaging Het
Gm5415 A T 1: 32,545,648 C394S probably damaging Het
Herc2 T C 7: 56,122,351 Y1093H probably damaging Het
Invs A G 4: 48,283,242 probably benign Het
Katnb1 T A 8: 95,097,980 I534N possibly damaging Het
Kcnq5 A T 1: 21,402,487 D826E probably damaging Het
Knl1 A G 2: 119,069,176 K453E probably damaging Het
Lgi4 C T 7: 31,070,757 probably benign Het
Lpin3 A G 2: 160,897,138 S289G probably benign Het
Mapre1 T A 2: 153,758,067 V137E possibly damaging Het
Mark4 A G 7: 19,447,243 F144L possibly damaging Het
Mogat2 G T 7: 99,223,635 A114E possibly damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Nell2 A G 15: 95,527,809 L19P possibly damaging Het
Nfia A T 4: 97,783,348 K98N probably damaging Het
Nutm1 T A 2: 112,249,000 T857S possibly damaging Het
Olfr146 T A 9: 39,018,702 I280F probably damaging Het
Olfr298 TG T 7: 86,489,291 probably null Het
Olfr68 T C 7: 103,777,404 K314E probably benign Het
Pde10a T C 17: 8,977,155 L706P probably damaging Het
Penk A G 4: 4,134,296 L117P probably damaging Het
Pgap1 A G 1: 54,481,856 S876P probably damaging Het
Pmfbp1 T C 8: 109,527,767 I478T possibly damaging Het
Pole G A 5: 110,294,934 E318K possibly damaging Het
Prr12 C A 7: 45,046,377 V1222L unknown Het
Prune2 T C 19: 17,216,357 S3070P possibly damaging Het
Rnf19a A G 15: 36,244,196 C573R probably benign Het
Rp1l1 T C 14: 64,030,180 S1072P probably damaging Het
Sh3pxd2a T C 19: 47,273,411 N315S possibly damaging Het
Snph T C 2: 151,594,544 I86V probably damaging Het
Sox6 A G 7: 115,777,228 Y90H probably damaging Het
Tbc1d13 T A 2: 30,142,311 C145S probably benign Het
Tcp11l1 T C 2: 104,699,944 E65G probably damaging Het
Thrb G T 14: 18,011,181 E186* probably null Het
Tmem101 A G 11: 102,156,233 Y38H possibly damaging Het
Tusc5 T A 11: 76,680,308 L50Q probably damaging Het
Urb1 A T 16: 90,783,274 probably null Het
Usp10 G A 8: 119,956,681 V764I possibly damaging Het
Usp25 A G 16: 77,109,227 E857G probably benign Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Wdr35 T C 12: 9,018,142 L775P probably damaging Het
Xpnpep1 T C 19: 53,013,414 T134A probably benign Het
Zbtb10 T C 3: 9,264,671 V363A probably damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Other mutations in Klra9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Klra9 APN 6 130179097 missense probably benign 0.04
IGL00685:Klra9 APN 6 130182406 missense probably damaging 1.00
IGL01083:Klra9 APN 6 130189766 missense possibly damaging 0.61
IGL01704:Klra9 APN 6 130189781 nonsense probably null
IGL02510:Klra9 APN 6 130191222 missense probably benign 0.17
IGL02728:Klra9 APN 6 130191186 splice site probably null
IGL02792:Klra9 APN 6 130188680 missense probably benign 0.19
Ashen UTSW 6 130179032 nonsense probably null
FR4589:Klra9 UTSW 6 130182403 missense probably benign 0.37
PIT4453001:Klra9 UTSW 6 130191321 start gained probably benign
R0410:Klra9 UTSW 6 130188744 missense probably benign 0.01
R0926:Klra9 UTSW 6 130179030 missense probably damaging 0.98
R1712:Klra9 UTSW 6 130189696 critical splice donor site probably null
R1897:Klra9 UTSW 6 130185592 missense possibly damaging 0.86
R1972:Klra9 UTSW 6 130182382 critical splice donor site probably null
R3683:Klra9 UTSW 6 130191297 missense probably benign
R4066:Klra9 UTSW 6 130188744 missense probably benign 0.02
R4687:Klra9 UTSW 6 130185517 missense probably benign 0.36
R5062:Klra9 UTSW 6 130179109 missense possibly damaging 0.77
R5479:Klra9 UTSW 6 130179112 missense probably benign 0.02
R5809:Klra9 UTSW 6 130179073 missense probably damaging 1.00
R6410:Klra9 UTSW 6 130178994 missense probably damaging 1.00
R6430:Klra9 UTSW 6 130179032 nonsense probably null
R6433:Klra9 UTSW 6 130179032 nonsense probably null
R6434:Klra9 UTSW 6 130179032 nonsense probably null
R6449:Klra9 UTSW 6 130179032 nonsense probably null
R6450:Klra9 UTSW 6 130179032 nonsense probably null
R6464:Klra9 UTSW 6 130179032 nonsense probably null
R6466:Klra9 UTSW 6 130179032 nonsense probably null
R6488:Klra9 UTSW 6 130179032 nonsense probably null
R6882:Klra9 UTSW 6 130179022 missense probably damaging 1.00
R6902:Klra9 UTSW 6 130179040 missense probably benign 0.11
R6946:Klra9 UTSW 6 130179040 missense probably benign 0.11
R7204:Klra9 UTSW 6 130188680 missense possibly damaging 0.53
R7229:Klra9 UTSW 6 130191261 missense probably damaging 0.98
R7544:Klra9 UTSW 6 130191220 missense probably benign 0.27
R7821:Klra9 UTSW 6 130185600 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCTTAAGCTGATGGATGTACTTC -3'
(R):5'- TGTTGGCTCTCCACATGAAG -3'

Sequencing Primer
(F):5'- GCTGATGGATGTACTTCAAAGC -3'
(R):5'- GGCTCTCCACATGAAGCCTTTTC -3'
Posted On2016-07-06