Incidental Mutation 'R0453:Dnhd1'
ID 39775
Institutional Source Beutler Lab
Gene Symbol Dnhd1
Ensembl Gene ENSMUSG00000030882
Gene Name dynein heavy chain domain 1
Synonyms 8030491N06Rik
MMRRC Submission 038653-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.089) question?
Stock # R0453 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 105300034-105371006 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 105323651 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 641 (T641A)
Ref Sequence ENSEMBL: ENSMUSP00000121261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106776] [ENSMUST00000142874] [ENSMUST00000145988] [ENSMUST00000210312]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000106776
SMART Domains Protein: ENSMUSP00000102388
Gene: ENSMUSG00000030882

DomainStartEndE-ValueType
low complexity region 205 224 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128388
Predicted Effect probably benign
Transcript: ENSMUST00000142874
Predicted Effect probably benign
Transcript: ENSMUST00000145988
AA Change: T641A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000121261
Gene: ENSMUSG00000030882
AA Change: T641A

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
low complexity region 183 191 N/A INTRINSIC
low complexity region 253 269 N/A INTRINSIC
low complexity region 943 962 N/A INTRINSIC
Pfam:DHC_N2 1018 1472 4.6e-50 PFAM
Pfam:AAA_6 1652 1875 2.7e-14 PFAM
low complexity region 1906 1918 N/A INTRINSIC
Blast:AAA 1993 2196 1e-34 BLAST
Pfam:AAA_7 2362 2610 3.3e-11 PFAM
low complexity region 2697 2714 N/A INTRINSIC
low complexity region 2722 2733 N/A INTRINSIC
low complexity region 2800 2810 N/A INTRINSIC
low complexity region 3116 3134 N/A INTRINSIC
Pfam:MT 3178 3470 3.9e-16 PFAM
coiled coil region 3590 3642 N/A INTRINSIC
coiled coil region 3816 3843 N/A INTRINSIC
Pfam:Dynein_heavy 3976 4746 7.3e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210312
Meta Mutation Damage Score 0.0671 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.6%
Validation Efficiency 99% (97/98)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T A 5: 121,765,445 (GRCm39) K843* probably null Het
Adam26b T C 8: 43,973,387 (GRCm39) I538M probably benign Het
Adamtsl1 T C 4: 86,150,852 (GRCm39) Y337H probably damaging Het
Ak7 T C 12: 105,682,307 (GRCm39) M156T probably damaging Het
Aldh3a1 A G 11: 61,106,338 (GRCm39) M238V probably benign Het
Asic4 T A 1: 75,450,155 (GRCm39) probably benign Het
AW551984 A G 9: 39,511,937 (GRCm39) S25P probably damaging Het
Bbs7 T A 3: 36,661,818 (GRCm39) Y127F possibly damaging Het
Bco1 G A 8: 117,835,516 (GRCm39) E156K possibly damaging Het
Becn1 T C 11: 101,181,275 (GRCm39) D342G probably damaging Het
Birc6 T A 17: 74,956,749 (GRCm39) I3575N probably damaging Het
Brd10 T C 19: 29,731,068 (GRCm39) Y715C probably damaging Het
Cc2d2a A T 5: 43,860,636 (GRCm39) M522L probably benign Het
Cerkl A G 2: 79,172,795 (GRCm39) F293L probably benign Het
Chil3 T G 3: 106,056,221 (GRCm39) N311T probably benign Het
Cpeb2 T A 5: 43,443,056 (GRCm39) probably benign Het
Cpxm2 A G 7: 131,730,134 (GRCm39) S162P probably damaging Het
Cracr2b A C 7: 141,044,176 (GRCm39) E136A probably damaging Het
Cyp2a4 T A 7: 26,012,258 (GRCm39) M347K probably benign Het
Dicer1 C A 12: 104,668,889 (GRCm39) R1264S probably benign Het
Dlgap1 T A 17: 71,068,341 (GRCm39) N609K probably benign Het
Egfl8 T C 17: 34,833,856 (GRCm39) Y74C probably damaging Het
Esyt1 A G 10: 128,348,078 (GRCm39) S901P probably benign Het
Fam83e A T 7: 45,373,372 (GRCm39) D246V probably damaging Het
Galnt2 T C 8: 125,065,323 (GRCm39) probably benign Het
Hdc A G 2: 126,436,871 (GRCm39) probably benign Het
Herc1 A C 9: 66,307,054 (GRCm39) Q958P probably benign Het
Iqcg T A 16: 32,870,213 (GRCm39) probably benign Het
Iqub A T 6: 24,450,829 (GRCm39) F590Y probably damaging Het
Jak2 T C 19: 29,289,238 (GRCm39) I1130T probably benign Het
Kbtbd11 G A 8: 15,077,499 (GRCm39) A33T probably benign Het
Kcnip4 A G 5: 48,667,054 (GRCm39) L37P probably damaging Het
Klk6 A G 7: 43,477,963 (GRCm39) N112D probably damaging Het
Kmt2c G A 5: 25,559,745 (GRCm39) T1011I probably damaging Het
Knl1 A T 2: 118,898,869 (GRCm39) K190M probably damaging Het
Lama3 T A 18: 12,598,535 (GRCm39) S981T possibly damaging Het
Lrrc18 T C 14: 32,730,608 (GRCm39) L49P probably damaging Het
Lrrc31 T C 3: 30,741,674 (GRCm39) E245G probably damaging Het
Lypd10 T A 7: 24,413,712 (GRCm39) S243T probably benign Het
Macf1 T C 4: 123,338,737 (GRCm39) I2456M probably benign Het
Mcm6 T A 1: 128,261,292 (GRCm39) T771S probably benign Het
Met A C 6: 17,534,197 (GRCm39) Y680S possibly damaging Het
Mixl1 T A 1: 180,524,211 (GRCm39) T123S probably damaging Het
Myh8 A T 11: 67,183,731 (GRCm39) I787F probably benign Het
Myocd A G 11: 65,087,051 (GRCm39) F292S probably damaging Het
Neb T C 2: 52,203,902 (GRCm39) probably null Het
Nfe2l1 A G 11: 96,718,194 (GRCm39) S114P probably damaging Het
Nrxn2 T C 19: 6,541,551 (GRCm39) S986P probably damaging Het
Oprl1 T C 2: 181,360,527 (GRCm39) probably null Het
Or11h6 T C 14: 50,880,461 (GRCm39) V241A possibly damaging Het
Or4a73 A T 2: 89,421,095 (GRCm39) Y121* probably null Het
Or5b101 T G 19: 13,005,295 (GRCm39) T133P probably damaging Het
Or6c8 A G 10: 128,915,640 (GRCm39) F64S probably damaging Het
Or8b53 G A 9: 38,667,425 (GRCm39) G147D probably damaging Het
Or8c9 A T 9: 38,241,467 (GRCm39) T195S probably benign Het
Panx2 T A 15: 88,952,610 (GRCm39) I359N probably damaging Het
Pik3c2b T A 1: 133,005,134 (GRCm39) V545E probably damaging Het
Piwil4 T C 9: 14,638,748 (GRCm39) N259S probably benign Het
Plcxd2 A T 16: 45,800,919 (GRCm39) F102I probably damaging Het
Pld5 A T 1: 175,917,522 (GRCm39) M75K possibly damaging Het
Pmp22 T A 11: 63,041,929 (GRCm39) probably benign Het
Polr2a A G 11: 69,631,845 (GRCm39) S1074P possibly damaging Het
Pop1 T A 15: 34,526,352 (GRCm39) V649E possibly damaging Het
Prc1 A G 7: 79,962,850 (GRCm39) N548S probably damaging Het
Prss51 T C 14: 64,334,588 (GRCm39) L202P probably damaging Het
Rhpn1 T C 15: 75,585,428 (GRCm39) S576P possibly damaging Het
Rictor A G 15: 6,738,123 (GRCm39) D20G probably benign Het
Rpl13a-ps1 A T 19: 50,018,645 (GRCm39) L177* probably null Het
Rpl23a-ps1 T G 1: 46,021,087 (GRCm39) noncoding transcript Het
Saa2 A G 7: 46,402,902 (GRCm39) D51G probably damaging Het
Sec31a A T 5: 100,551,977 (GRCm39) probably benign Het
Secisbp2 G A 13: 51,837,361 (GRCm39) E841K possibly damaging Het
Serinc1 A G 10: 57,393,306 (GRCm39) Y437H probably damaging Het
Slc39a12 A T 2: 14,440,492 (GRCm39) H481L probably benign Het
Suz12 T A 11: 79,920,859 (GRCm39) N586K probably damaging Het
Synm T C 7: 67,386,630 (GRCm39) Y344C possibly damaging Het
Tas2r104 A G 6: 131,662,304 (GRCm39) V135A probably benign Het
Tdrd9 T C 12: 112,034,673 (GRCm39) S1371P probably benign Het
Tg T A 15: 66,700,382 (GRCm39) D893E probably benign Het
Thoc5 C A 11: 4,868,217 (GRCm39) D423E possibly damaging Het
Trim11 G A 11: 58,881,361 (GRCm39) R418H probably damaging Het
Trim52 T G 14: 106,344,399 (GRCm39) V19G probably damaging Het
Tuba4a C A 1: 75,192,502 (GRCm39) V371L probably damaging Het
Ugt8a A G 3: 125,708,606 (GRCm39) V168A probably benign Het
Ulk1 C T 5: 110,938,951 (GRCm39) G496R probably damaging Het
Usp40 A G 1: 87,874,320 (GRCm39) *1236Q probably null Het
Vmn2r100 C A 17: 19,742,382 (GRCm39) P252Q possibly damaging Het
Vmn2r24 A G 6: 123,757,350 (GRCm39) probably null Het
Vmn2r53 A G 7: 12,316,338 (GRCm39) Y494H probably damaging Het
Vmn2r65 T A 7: 84,595,442 (GRCm39) D414V probably benign Het
Wdr26 A T 1: 181,010,444 (GRCm39) L519* probably null Het
Wnk1 A G 6: 119,940,112 (GRCm39) V173A probably damaging Het
Zfp217 C T 2: 169,957,382 (GRCm39) A539T probably benign Het
Zfp318 T C 17: 46,707,634 (GRCm39) S231P probably damaging Het
Zfp398 T C 6: 47,842,782 (GRCm39) V146A probably benign Het
Zfp410 T C 12: 84,378,486 (GRCm39) M270T probably damaging Het
Zfp445 A T 9: 122,682,578 (GRCm39) H454Q possibly damaging Het
Other mutations in Dnhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Dnhd1 APN 7 105,327,202 (GRCm39) missense probably damaging 1.00
IGL00516:Dnhd1 APN 7 105,306,418 (GRCm39) missense possibly damaging 0.52
IGL00576:Dnhd1 APN 7 105,341,882 (GRCm39) missense probably damaging 1.00
IGL00990:Dnhd1 APN 7 105,370,895 (GRCm39) missense possibly damaging 0.85
IGL01346:Dnhd1 APN 7 105,363,116 (GRCm39) missense probably benign
IGL01714:Dnhd1 APN 7 105,370,149 (GRCm39) missense probably damaging 1.00
IGL01735:Dnhd1 APN 7 105,362,961 (GRCm39) missense probably benign 0.37
IGL01814:Dnhd1 APN 7 105,301,237 (GRCm39) missense probably benign
IGL01999:Dnhd1 APN 7 105,370,422 (GRCm39) missense possibly damaging 0.50
IGL02022:Dnhd1 APN 7 105,327,516 (GRCm39) missense probably damaging 1.00
IGL02131:Dnhd1 APN 7 105,370,009 (GRCm39) missense probably damaging 1.00
IGL02156:Dnhd1 APN 7 105,370,951 (GRCm39) missense probably damaging 1.00
IGL02674:Dnhd1 APN 7 105,370,688 (GRCm39) missense probably benign 0.00
IGL02966:Dnhd1 APN 7 105,369,948 (GRCm39) missense probably benign 0.00
IGL03066:Dnhd1 APN 7 105,369,089 (GRCm39) missense probably damaging 0.99
IGL03298:Dnhd1 APN 7 105,363,682 (GRCm39) missense probably damaging 0.98
IGL03378:Dnhd1 APN 7 105,362,940 (GRCm39) missense possibly damaging 0.87
IGL02802:Dnhd1 UTSW 7 105,304,930 (GRCm39) missense possibly damaging 0.83
R0060:Dnhd1 UTSW 7 105,317,721 (GRCm39) missense probably damaging 0.99
R0129:Dnhd1 UTSW 7 105,370,131 (GRCm39) missense probably benign 0.19
R0238:Dnhd1 UTSW 7 105,370,738 (GRCm39) missense probably benign 0.06
R0238:Dnhd1 UTSW 7 105,370,738 (GRCm39) missense probably benign 0.06
R0239:Dnhd1 UTSW 7 105,370,738 (GRCm39) missense probably benign 0.06
R0239:Dnhd1 UTSW 7 105,370,738 (GRCm39) missense probably benign 0.06
R0384:Dnhd1 UTSW 7 105,369,321 (GRCm39) missense possibly damaging 0.56
R0540:Dnhd1 UTSW 7 105,369,995 (GRCm39) missense probably benign 0.04
R0554:Dnhd1 UTSW 7 105,343,602 (GRCm39) missense probably benign 0.10
R0576:Dnhd1 UTSW 7 105,363,252 (GRCm39) missense probably damaging 1.00
R0607:Dnhd1 UTSW 7 105,369,995 (GRCm39) missense probably benign 0.04
R0631:Dnhd1 UTSW 7 105,300,831 (GRCm39) missense probably benign 0.17
R0639:Dnhd1 UTSW 7 105,345,671 (GRCm39) missense possibly damaging 0.95
R0668:Dnhd1 UTSW 7 105,344,958 (GRCm39) missense probably benign
R0669:Dnhd1 UTSW 7 105,342,911 (GRCm39) missense probably benign 0.01
R0670:Dnhd1 UTSW 7 105,345,671 (GRCm39) missense possibly damaging 0.95
R0699:Dnhd1 UTSW 7 105,301,113 (GRCm39) missense probably damaging 0.98
R1019:Dnhd1 UTSW 7 105,358,378 (GRCm39) missense probably damaging 1.00
R1144:Dnhd1 UTSW 7 105,362,238 (GRCm39) missense probably damaging 1.00
R1226:Dnhd1 UTSW 7 105,346,106 (GRCm39) missense probably damaging 1.00
R1257:Dnhd1 UTSW 7 105,343,360 (GRCm39) missense probably damaging 1.00
R1391:Dnhd1 UTSW 7 105,369,331 (GRCm39) missense probably damaging 1.00
R1453:Dnhd1 UTSW 7 105,370,480 (GRCm39) critical splice donor site probably null
R1501:Dnhd1 UTSW 7 105,317,670 (GRCm39) missense probably benign 0.00
R1503:Dnhd1 UTSW 7 105,342,867 (GRCm39) missense possibly damaging 0.67
R1515:Dnhd1 UTSW 7 105,353,355 (GRCm39) missense probably benign 0.11
R1615:Dnhd1 UTSW 7 105,362,913 (GRCm39) missense possibly damaging 0.74
R1615:Dnhd1 UTSW 7 105,352,413 (GRCm39) missense probably benign 0.00
R1656:Dnhd1 UTSW 7 105,363,488 (GRCm39) missense probably damaging 1.00
R1720:Dnhd1 UTSW 7 105,343,035 (GRCm39) missense probably benign
R1723:Dnhd1 UTSW 7 105,364,127 (GRCm39) missense possibly damaging 0.60
R1766:Dnhd1 UTSW 7 105,343,179 (GRCm39) missense possibly damaging 0.50
R1799:Dnhd1 UTSW 7 105,304,974 (GRCm39) missense probably benign 0.31
R1860:Dnhd1 UTSW 7 105,353,412 (GRCm39) missense probably benign
R1920:Dnhd1 UTSW 7 105,362,614 (GRCm39) missense probably benign 0.00
R1925:Dnhd1 UTSW 7 105,323,061 (GRCm39) missense probably damaging 0.96
R1925:Dnhd1 UTSW 7 105,301,459 (GRCm39) missense probably damaging 1.00
R1934:Dnhd1 UTSW 7 105,357,789 (GRCm39) missense probably benign 0.05
R1935:Dnhd1 UTSW 7 105,323,183 (GRCm39) missense probably benign 0.09
R1936:Dnhd1 UTSW 7 105,323,183 (GRCm39) missense probably benign 0.09
R2035:Dnhd1 UTSW 7 105,354,128 (GRCm39) missense probably damaging 0.99
R2125:Dnhd1 UTSW 7 105,327,178 (GRCm39) missense probably benign 0.35
R2127:Dnhd1 UTSW 7 105,342,928 (GRCm39) missense possibly damaging 0.56
R2254:Dnhd1 UTSW 7 105,352,979 (GRCm39) missense probably damaging 1.00
R2301:Dnhd1 UTSW 7 105,354,606 (GRCm39) missense probably damaging 1.00
R2316:Dnhd1 UTSW 7 105,323,628 (GRCm39) missense probably damaging 1.00
R2324:Dnhd1 UTSW 7 105,359,297 (GRCm39) missense probably damaging 1.00
R2337:Dnhd1 UTSW 7 105,352,674 (GRCm39) missense probably benign 0.07
R2381:Dnhd1 UTSW 7 105,342,871 (GRCm39) missense probably benign 0.42
R2394:Dnhd1 UTSW 7 105,369,438 (GRCm39) missense probably benign 0.19
R2862:Dnhd1 UTSW 7 105,361,766 (GRCm39) missense probably benign 0.01
R3038:Dnhd1 UTSW 7 105,369,436 (GRCm39) missense probably damaging 0.99
R3114:Dnhd1 UTSW 7 105,345,772 (GRCm39) critical splice donor site probably null
R3404:Dnhd1 UTSW 7 105,343,968 (GRCm39) nonsense probably null
R3405:Dnhd1 UTSW 7 105,343,968 (GRCm39) nonsense probably null
R3439:Dnhd1 UTSW 7 105,343,992 (GRCm39) missense probably damaging 1.00
R3959:Dnhd1 UTSW 7 105,362,329 (GRCm39) missense probably benign 0.21
R4014:Dnhd1 UTSW 7 105,364,045 (GRCm39) missense probably damaging 0.99
R4084:Dnhd1 UTSW 7 105,358,795 (GRCm39) missense probably damaging 1.00
R4181:Dnhd1 UTSW 7 105,343,161 (GRCm39) missense probably damaging 1.00
R4255:Dnhd1 UTSW 7 105,362,205 (GRCm39) missense probably damaging 1.00
R4302:Dnhd1 UTSW 7 105,343,161 (GRCm39) missense probably damaging 1.00
R4440:Dnhd1 UTSW 7 105,345,935 (GRCm39) nonsense probably null
R4565:Dnhd1 UTSW 7 105,301,163 (GRCm39) missense possibly damaging 0.92
R4569:Dnhd1 UTSW 7 105,306,373 (GRCm39) splice site probably null
R4584:Dnhd1 UTSW 7 105,327,256 (GRCm39) missense probably damaging 1.00
R4586:Dnhd1 UTSW 7 105,327,256 (GRCm39) missense probably damaging 1.00
R4590:Dnhd1 UTSW 7 105,363,237 (GRCm39) missense probably damaging 1.00
R4593:Dnhd1 UTSW 7 105,364,653 (GRCm39) missense probably benign 0.02
R4600:Dnhd1 UTSW 7 105,352,851 (GRCm39) missense probably damaging 1.00
R4705:Dnhd1 UTSW 7 105,304,948 (GRCm39) missense probably damaging 1.00
R4731:Dnhd1 UTSW 7 105,323,056 (GRCm39) missense probably benign 0.00
R4732:Dnhd1 UTSW 7 105,323,056 (GRCm39) missense probably benign 0.00
R4733:Dnhd1 UTSW 7 105,323,056 (GRCm39) missense probably benign 0.00
R4786:Dnhd1 UTSW 7 105,323,651 (GRCm39) missense probably benign 0.00
R4791:Dnhd1 UTSW 7 105,370,324 (GRCm39) missense probably damaging 1.00
R4811:Dnhd1 UTSW 7 105,363,488 (GRCm39) missense probably damaging 0.99
R4822:Dnhd1 UTSW 7 105,353,171 (GRCm39) missense probably benign 0.00
R4886:Dnhd1 UTSW 7 105,364,015 (GRCm39) missense probably benign 0.00
R4890:Dnhd1 UTSW 7 105,306,164 (GRCm39) missense possibly damaging 0.47
R4973:Dnhd1 UTSW 7 105,362,840 (GRCm39) missense probably benign 0.24
R5007:Dnhd1 UTSW 7 105,362,283 (GRCm39) missense probably damaging 1.00
R5048:Dnhd1 UTSW 7 105,342,904 (GRCm39) missense probably benign 0.01
R5151:Dnhd1 UTSW 7 105,362,647 (GRCm39) missense probably benign 0.22
R5179:Dnhd1 UTSW 7 105,363,759 (GRCm39) missense probably damaging 1.00
R5182:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5183:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5185:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5209:Dnhd1 UTSW 7 105,345,667 (GRCm39) missense probably benign 0.00
R5225:Dnhd1 UTSW 7 105,353,130 (GRCm39) missense possibly damaging 0.73
R5250:Dnhd1 UTSW 7 105,334,968 (GRCm39) missense probably damaging 1.00
R5257:Dnhd1 UTSW 7 105,323,244 (GRCm39) missense probably benign
R5258:Dnhd1 UTSW 7 105,323,244 (GRCm39) missense probably benign
R5273:Dnhd1 UTSW 7 105,363,689 (GRCm39) missense probably damaging 0.99
R5288:Dnhd1 UTSW 7 105,363,644 (GRCm39) missense possibly damaging 0.94
R5396:Dnhd1 UTSW 7 105,362,891 (GRCm39) missense probably benign 0.00
R5453:Dnhd1 UTSW 7 105,359,330 (GRCm39) missense probably damaging 1.00
R5511:Dnhd1 UTSW 7 105,363,363 (GRCm39) missense probably damaging 1.00
R5518:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5523:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5528:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5529:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5561:Dnhd1 UTSW 7 105,364,028 (GRCm39) missense probably damaging 0.99
R5681:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5682:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5683:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5684:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5686:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5697:Dnhd1 UTSW 7 105,323,395 (GRCm39) missense probably damaging 1.00
R5789:Dnhd1 UTSW 7 105,354,217 (GRCm39) missense possibly damaging 0.50
R5790:Dnhd1 UTSW 7 105,304,981 (GRCm39) missense probably damaging 1.00
R5814:Dnhd1 UTSW 7 105,369,102 (GRCm39) missense possibly damaging 0.69
R5828:Dnhd1 UTSW 7 105,369,388 (GRCm39) missense probably benign 0.00
R5852:Dnhd1 UTSW 7 105,344,955 (GRCm39) missense probably damaging 1.00
R5883:Dnhd1 UTSW 7 105,369,711 (GRCm39) missense probably damaging 0.98
R6115:Dnhd1 UTSW 7 105,363,194 (GRCm39) missense probably benign 0.00
R6119:Dnhd1 UTSW 7 105,358,647 (GRCm39) missense probably benign 0.18
R6212:Dnhd1 UTSW 7 105,353,255 (GRCm39) missense probably damaging 1.00
R6243:Dnhd1 UTSW 7 105,301,216 (GRCm39) missense probably damaging 1.00
R6265:Dnhd1 UTSW 7 105,342,577 (GRCm39) missense probably benign 0.07
R6332:Dnhd1 UTSW 7 105,343,273 (GRCm39) missense probably benign 0.02
R6344:Dnhd1 UTSW 7 105,343,817 (GRCm39) missense probably benign 0.38
R6477:Dnhd1 UTSW 7 105,327,093 (GRCm39) missense probably benign 0.05
R6642:Dnhd1 UTSW 7 105,353,006 (GRCm39) missense probably benign
R6663:Dnhd1 UTSW 7 105,334,899 (GRCm39) splice site probably null
R6730:Dnhd1 UTSW 7 105,353,082 (GRCm39) missense probably benign 0.00
R6748:Dnhd1 UTSW 7 105,369,844 (GRCm39) missense probably benign 0.03
R6833:Dnhd1 UTSW 7 105,352,580 (GRCm39) missense probably benign 0.01
R6850:Dnhd1 UTSW 7 105,369,137 (GRCm39) missense possibly damaging 0.68
R6853:Dnhd1 UTSW 7 105,352,935 (GRCm39) missense probably benign
R6860:Dnhd1 UTSW 7 105,327,473 (GRCm39) missense probably benign
R6898:Dnhd1 UTSW 7 105,336,584 (GRCm39) missense probably damaging 0.99
R6927:Dnhd1 UTSW 7 105,364,770 (GRCm39) missense probably damaging 1.00
R6952:Dnhd1 UTSW 7 105,362,895 (GRCm39) missense probably damaging 1.00
R6987:Dnhd1 UTSW 7 105,353,792 (GRCm39) missense probably damaging 0.98
R6988:Dnhd1 UTSW 7 105,363,417 (GRCm39) missense probably damaging 1.00
R7022:Dnhd1 UTSW 7 105,370,005 (GRCm39) missense probably benign 0.36
R7053:Dnhd1 UTSW 7 105,344,161 (GRCm39) missense probably damaging 1.00
R7085:Dnhd1 UTSW 7 105,364,468 (GRCm39) missense probably benign 0.26
R7086:Dnhd1 UTSW 7 105,357,739 (GRCm39) missense probably benign 0.03
R7112:Dnhd1 UTSW 7 105,363,192 (GRCm39) missense probably damaging 1.00
R7140:Dnhd1 UTSW 7 105,342,973 (GRCm39) missense probably benign 0.00
R7151:Dnhd1 UTSW 7 105,359,234 (GRCm39) missense probably benign 0.03
R7178:Dnhd1 UTSW 7 105,344,200 (GRCm39) missense probably damaging 0.98
R7326:Dnhd1 UTSW 7 105,370,137 (GRCm39) missense probably damaging 0.96
R7345:Dnhd1 UTSW 7 105,353,174 (GRCm39) missense probably benign 0.17
R7349:Dnhd1 UTSW 7 105,359,330 (GRCm39) missense probably damaging 1.00
R7397:Dnhd1 UTSW 7 105,354,504 (GRCm39) missense possibly damaging 0.87
R7520:Dnhd1 UTSW 7 105,345,255 (GRCm39) missense probably benign 0.07
R7536:Dnhd1 UTSW 7 105,358,768 (GRCm39) missense probably damaging 1.00
R7539:Dnhd1 UTSW 7 105,370,119 (GRCm39) missense probably damaging 1.00
R7541:Dnhd1 UTSW 7 105,327,516 (GRCm39) missense probably damaging 1.00
R7619:Dnhd1 UTSW 7 105,323,475 (GRCm39) missense probably benign 0.01
R7676:Dnhd1 UTSW 7 105,333,294 (GRCm39) missense probably benign 0.09
R7689:Dnhd1 UTSW 7 105,363,170 (GRCm39) missense probably benign 0.07
R7712:Dnhd1 UTSW 7 105,300,831 (GRCm39) missense probably benign 0.17
R7729:Dnhd1 UTSW 7 105,354,472 (GRCm39) missense probably damaging 1.00
R7767:Dnhd1 UTSW 7 105,343,817 (GRCm39) missense probably benign 0.38
R7768:Dnhd1 UTSW 7 105,370,302 (GRCm39) missense possibly damaging 0.87
R7779:Dnhd1 UTSW 7 105,327,122 (GRCm39) missense probably benign 0.01
R7879:Dnhd1 UTSW 7 105,352,646 (GRCm39) missense probably benign 0.09
R7922:Dnhd1 UTSW 7 105,317,721 (GRCm39) missense probably damaging 1.00
R7951:Dnhd1 UTSW 7 105,327,211 (GRCm39) missense probably damaging 1.00
R8259:Dnhd1 UTSW 7 105,343,995 (GRCm39) missense probably benign 0.38
R8350:Dnhd1 UTSW 7 105,327,231 (GRCm39) missense probably damaging 0.99
R8380:Dnhd1 UTSW 7 105,327,073 (GRCm39) missense probably benign 0.31
R8392:Dnhd1 UTSW 7 105,352,550 (GRCm39) missense possibly damaging 0.84
R8478:Dnhd1 UTSW 7 105,332,001 (GRCm39) missense probably benign 0.00
R8708:Dnhd1 UTSW 7 105,343,487 (GRCm39) nonsense probably null
R8767:Dnhd1 UTSW 7 105,301,330 (GRCm39) missense probably damaging 1.00
R8825:Dnhd1 UTSW 7 105,343,174 (GRCm39) missense possibly damaging 0.95
R8849:Dnhd1 UTSW 7 105,370,723 (GRCm39) missense probably benign 0.00
R8903:Dnhd1 UTSW 7 105,362,855 (GRCm39) nonsense probably null
R8910:Dnhd1 UTSW 7 105,332,904 (GRCm39) missense possibly damaging 0.92
R8940:Dnhd1 UTSW 7 105,363,854 (GRCm39) intron probably benign
R8954:Dnhd1 UTSW 7 105,343,986 (GRCm39) missense probably benign 0.35
R8956:Dnhd1 UTSW 7 105,341,852 (GRCm39) missense probably damaging 0.99
R8971:Dnhd1 UTSW 7 105,358,528 (GRCm39) nonsense probably null
R8996:Dnhd1 UTSW 7 105,323,242 (GRCm39) missense probably damaging 1.00
R9051:Dnhd1 UTSW 7 105,341,933 (GRCm39) missense possibly damaging 0.54
R9058:Dnhd1 UTSW 7 105,333,270 (GRCm39) missense probably benign 0.01
R9109:Dnhd1 UTSW 7 105,333,173 (GRCm39) missense probably damaging 0.98
R9284:Dnhd1 UTSW 7 105,301,091 (GRCm39) missense probably damaging 1.00
R9295:Dnhd1 UTSW 7 105,363,348 (GRCm39) missense probably benign
R9298:Dnhd1 UTSW 7 105,333,173 (GRCm39) missense probably damaging 0.98
R9299:Dnhd1 UTSW 7 105,369,806 (GRCm39) missense probably benign 0.00
R9308:Dnhd1 UTSW 7 105,353,484 (GRCm39) missense probably damaging 1.00
R9337:Dnhd1 UTSW 7 105,369,806 (GRCm39) missense probably benign 0.00
R9385:Dnhd1 UTSW 7 105,361,972 (GRCm39) missense probably damaging 1.00
R9463:Dnhd1 UTSW 7 105,344,223 (GRCm39) missense probably benign
R9463:Dnhd1 UTSW 7 105,306,454 (GRCm39) missense probably benign 0.00
R9476:Dnhd1 UTSW 7 105,352,889 (GRCm39) missense possibly damaging 0.74
R9489:Dnhd1 UTSW 7 105,300,804 (GRCm39) missense probably benign
R9500:Dnhd1 UTSW 7 105,353,709 (GRCm39) missense probably benign
R9510:Dnhd1 UTSW 7 105,352,889 (GRCm39) missense possibly damaging 0.74
R9513:Dnhd1 UTSW 7 105,354,179 (GRCm39) missense probably damaging 1.00
R9537:Dnhd1 UTSW 7 105,344,740 (GRCm39) missense probably damaging 0.99
R9567:Dnhd1 UTSW 7 105,353,473 (GRCm39) missense probably benign 0.03
R9622:Dnhd1 UTSW 7 105,353,342 (GRCm39) missense probably benign
R9623:Dnhd1 UTSW 7 105,344,134 (GRCm39) missense probably damaging 1.00
R9623:Dnhd1 UTSW 7 105,335,773 (GRCm39) missense probably damaging 1.00
R9674:Dnhd1 UTSW 7 105,363,429 (GRCm39) missense probably damaging 1.00
R9756:Dnhd1 UTSW 7 105,353,135 (GRCm39) missense probably benign 0.19
R9777:Dnhd1 UTSW 7 105,369,456 (GRCm39) missense probably benign 0.14
R9778:Dnhd1 UTSW 7 105,353,240 (GRCm39) missense probably benign
R9781:Dnhd1 UTSW 7 105,352,917 (GRCm39) missense probably benign 0.31
R9796:Dnhd1 UTSW 7 105,342,537 (GRCm39) missense probably damaging 1.00
Z1088:Dnhd1 UTSW 7 105,361,934 (GRCm39) missense probably benign 0.00
Z1176:Dnhd1 UTSW 7 105,352,243 (GRCm39) critical splice acceptor site probably null
Z1176:Dnhd1 UTSW 7 105,327,506 (GRCm39) missense probably benign
Z1176:Dnhd1 UTSW 7 105,317,754 (GRCm39) missense probably damaging 0.98
Z1176:Dnhd1 UTSW 7 105,352,787 (GRCm39) frame shift probably null
Z1177:Dnhd1 UTSW 7 105,332,048 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GTCACCTATGCCCCGTGTTGAATC -3'
(R):5'- AACATTAACCAGCTTAGAGCTGCCC -3'

Sequencing Primer
(F):5'- AGGGTCTCATTAAGAGCCTGC -3'
(R):5'- TTAGAGCTGCCCTATTACATCCAAG -3'
Posted On 2013-05-23