Incidental Mutation 'R5184:Mogat2'
ID397755
Institutional Source Beutler Lab
Gene Symbol Mogat2
Ensembl Gene ENSMUSG00000052396
Gene Namemonoacylglycerol O-acyltransferase 2
SynonymsDGAT2L5, Mgat2
MMRRC Submission 042763-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R5184 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location99219084-99238619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 99223635 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 114 (A114E)
Ref Sequence ENSEMBL: ENSMUSP00000064041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064231]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064231
AA Change: A114E

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000064041
Gene: ENSMUSG00000052396
AA Change: A114E

DomainStartEndE-ValueType
Pfam:DAGAT 39 334 9.1e-120 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208323
Meta Mutation Damage Score 0.2337 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzyme that catalyzes the synthesis of diacylglycerol from 2-monoacylglycerol and fatty acyl-CoA. The encoded protein is important in the uptake of dietary fat by the small intestine. This protein forms a complex with diacylglycerol O-acyltransferase 2 in the endoplasmic reticulum, and this complex catalyzes the synthesis of triacylglycerol. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit resistance to diet induced obesity, hyperinsulinemia, hyperlipidemia, and steatosis with decreased lipid absorption and increased oxygen consumption when fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aph1a T A 3: 95,895,739 probably null Het
Arid3a A G 10: 79,950,769 E452G possibly damaging Het
Barhl2 A G 5: 106,457,640 S68P unknown Het
BC030499 T C 11: 78,292,747 F194L probably benign Het
Carf T C 1: 60,108,174 S17P probably damaging Het
Ccdc90b A G 7: 92,574,811 D145G probably damaging Het
Cyp7a1 A T 4: 6,271,207 N316K probably benign Het
Daam2 A G 17: 49,494,391 I106T possibly damaging Het
Dmtf1 A G 5: 9,126,641 V437A probably benign Het
E2f2 A T 4: 136,184,440 Y254F possibly damaging Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Ern2 T C 7: 122,179,959 T221A probably benign Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fermt1 A G 2: 132,941,963 V42A possibly damaging Het
Fgf3 A G 7: 144,842,810 D187G probably damaging Het
Flnb T A 14: 7,901,945 V936E probably damaging Het
Gm5415 A T 1: 32,545,648 C394S probably damaging Het
Herc2 T C 7: 56,122,351 Y1093H probably damaging Het
Invs A G 4: 48,283,242 probably benign Het
Katnb1 T A 8: 95,097,980 I534N possibly damaging Het
Kcnq5 A T 1: 21,402,487 D826E probably damaging Het
Klra9 A T 6: 130,188,712 N113K probably benign Het
Knl1 A G 2: 119,069,176 K453E probably damaging Het
Lgi4 C T 7: 31,070,757 probably benign Het
Lpin3 A G 2: 160,897,138 S289G probably benign Het
Mapre1 T A 2: 153,758,067 V137E possibly damaging Het
Mark4 A G 7: 19,447,243 F144L possibly damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Nell2 A G 15: 95,527,809 L19P possibly damaging Het
Nfia A T 4: 97,783,348 K98N probably damaging Het
Nutm1 T A 2: 112,249,000 T857S possibly damaging Het
Olfr146 T A 9: 39,018,702 I280F probably damaging Het
Olfr298 TG T 7: 86,489,291 probably null Het
Olfr68 T C 7: 103,777,404 K314E probably benign Het
Pde10a T C 17: 8,977,155 L706P probably damaging Het
Penk A G 4: 4,134,296 L117P probably damaging Het
Pgap1 A G 1: 54,481,856 S876P probably damaging Het
Pmfbp1 T C 8: 109,527,767 I478T possibly damaging Het
Pole G A 5: 110,294,934 E318K possibly damaging Het
Prr12 C A 7: 45,046,377 V1222L unknown Het
Prune2 T C 19: 17,216,357 S3070P possibly damaging Het
Rnf19a A G 15: 36,244,196 C573R probably benign Het
Rp1l1 T C 14: 64,030,180 S1072P probably damaging Het
Sh3pxd2a T C 19: 47,273,411 N315S possibly damaging Het
Snph T C 2: 151,594,544 I86V probably damaging Het
Sox6 A G 7: 115,777,228 Y90H probably damaging Het
Tbc1d13 T A 2: 30,142,311 C145S probably benign Het
Tcp11l1 T C 2: 104,699,944 E65G probably damaging Het
Thrb G T 14: 18,011,181 E186* probably null Het
Tmem101 A G 11: 102,156,233 Y38H possibly damaging Het
Tusc5 T A 11: 76,680,308 L50Q probably damaging Het
Urb1 A T 16: 90,783,274 probably null Het
Usp10 G A 8: 119,956,681 V764I possibly damaging Het
Usp25 A G 16: 77,109,227 E857G probably benign Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Wdr35 T C 12: 9,018,142 L775P probably damaging Het
Xpnpep1 T C 19: 53,013,414 T134A probably benign Het
Zbtb10 T C 3: 9,264,671 V363A probably damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Other mutations in Mogat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Mogat2 APN 7 99232568 missense possibly damaging 0.60
IGL02052:Mogat2 APN 7 99238564 start codon destroyed probably null 0.99
IGL02153:Mogat2 APN 7 99223554 missense possibly damaging 0.94
R0227:Mogat2 UTSW 7 99223132 missense probably benign 0.02
R0490:Mogat2 UTSW 7 99223144 missense probably benign 0.11
R1331:Mogat2 UTSW 7 99223515 missense possibly damaging 0.66
R1546:Mogat2 UTSW 7 99232559 missense probably damaging 1.00
R2879:Mogat2 UTSW 7 99222366 missense possibly damaging 0.46
R4954:Mogat2 UTSW 7 99238517 missense possibly damaging 0.95
R5040:Mogat2 UTSW 7 99238517 missense possibly damaging 0.95
R5822:Mogat2 UTSW 7 99219905 missense possibly damaging 0.82
R6056:Mogat2 UTSW 7 99223513 missense possibly damaging 0.95
R6256:Mogat2 UTSW 7 99219895 missense probably damaging 1.00
R6500:Mogat2 UTSW 7 99222346 missense probably benign 0.04
R7358:Mogat2 UTSW 7 99232466 missense possibly damaging 0.93
R7375:Mogat2 UTSW 7 99223698 missense probably damaging 1.00
Y5408:Mogat2 UTSW 7 99223630 missense probably damaging 1.00
Z1177:Mogat2 UTSW 7 99223629 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAGCTGTTGACAGTCC -3'
(R):5'- CCCATCTCTGTGGAAGCATC -3'

Sequencing Primer
(F):5'- AGTCCTCTGTCAGATCCCC -3'
(R):5'- GGAAGCATCCAGTATACTCAGG -3'
Posted On2016-07-06