Incidental Mutation 'R5184:Or8g17'
ID 397763
Institutional Source Beutler Lab
Gene Symbol Or8g17
Ensembl Gene ENSMUSG00000058820
Gene Name olfactory receptor family 8 subfamily G member 17
Synonyms MOR171-10, M15, Olfr146, GA_x6K02T2PVTD-32715386-32714466
MMRRC Submission 042763-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R5184 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 38929915-38930835 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 38929998 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 280 (I280F)
Ref Sequence ENSEMBL: ENSMUSP00000149294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073671] [ENSMUST00000214369] [ENSMUST00000214410] [ENSMUST00000215383]
AlphaFold Q60884
Predicted Effect probably damaging
Transcript: ENSMUST00000073671
AA Change: I280F

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073352
Gene: ENSMUSG00000058820
AA Change: I280F

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 7.6e-54 PFAM
Pfam:7tm_1 41 290 8.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214369
Predicted Effect probably damaging
Transcript: ENSMUST00000214410
AA Change: I280F

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000215383
Meta Mutation Damage Score 0.3209 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aph1a T A 3: 95,803,051 (GRCm39) probably null Het
Arid3a A G 10: 79,786,603 (GRCm39) E452G possibly damaging Het
Barhl2 A G 5: 106,605,506 (GRCm39) S68P unknown Het
Carf T C 1: 60,147,333 (GRCm39) S17P probably damaging Het
Ccdc90b A G 7: 92,224,019 (GRCm39) D145G probably damaging Het
Cyp7a1 A T 4: 6,271,207 (GRCm39) N316K probably benign Het
Daam2 A G 17: 49,801,419 (GRCm39) I106T possibly damaging Het
Dmtf1 A G 5: 9,176,641 (GRCm39) V437A probably benign Het
E2f2 A T 4: 135,911,751 (GRCm39) Y254F possibly damaging Het
Ehmt1 G T 2: 24,767,509 (GRCm39) P135T probably damaging Het
Ern2 T C 7: 121,779,182 (GRCm39) T221A probably benign Het
Fam227b G A 2: 125,958,043 (GRCm39) P241S probably damaging Het
Fermt1 A G 2: 132,783,883 (GRCm39) V42A possibly damaging Het
Fgf3 A G 7: 144,396,547 (GRCm39) D187G probably damaging Het
Flnb T A 14: 7,901,945 (GRCm38) V936E probably damaging Het
Herc2 T C 7: 55,772,099 (GRCm39) Y1093H probably damaging Het
Invs A G 4: 48,283,242 (GRCm39) probably benign Het
Katnb1 T A 8: 95,824,608 (GRCm39) I534N possibly damaging Het
Kcnq5 A T 1: 21,472,711 (GRCm39) D826E probably damaging Het
Klra9 A T 6: 130,165,675 (GRCm39) N113K probably benign Het
Knl1 A G 2: 118,899,657 (GRCm39) K453E probably damaging Het
Lgi4 C T 7: 30,770,182 (GRCm39) probably benign Het
Lpin3 A G 2: 160,739,058 (GRCm39) S289G probably benign Het
Mapre1 T A 2: 153,599,987 (GRCm39) V137E possibly damaging Het
Mark4 A G 7: 19,181,168 (GRCm39) F144L possibly damaging Het
Mogat2 G T 7: 98,872,842 (GRCm39) A114E possibly damaging Het
Msh2 C A 17: 88,030,841 (GRCm39) A906E probably benign Het
Nell2 A G 15: 95,425,690 (GRCm39) L19P possibly damaging Het
Nfia A T 4: 97,671,585 (GRCm39) K98N probably damaging Het
Nutm1 T A 2: 112,079,345 (GRCm39) T857S possibly damaging Het
Or14a257 TG T 7: 86,138,499 (GRCm39) probably null Het
Or52a5 T C 7: 103,426,611 (GRCm39) K314E probably benign Het
Pde10a T C 17: 9,195,987 (GRCm39) L706P probably damaging Het
Penk A G 4: 4,134,296 (GRCm39) L117P probably damaging Het
Pgap1 A G 1: 54,521,015 (GRCm39) S876P probably damaging Het
Pmfbp1 T C 8: 110,254,399 (GRCm39) I478T possibly damaging Het
Pole G A 5: 110,442,800 (GRCm39) E318K possibly damaging Het
Prr12 C A 7: 44,695,801 (GRCm39) V1222L unknown Het
Prune2 T C 19: 17,193,721 (GRCm39) S3070P possibly damaging Het
Rnf19a A G 15: 36,244,342 (GRCm39) C573R probably benign Het
Rp1l1 T C 14: 64,267,629 (GRCm39) S1072P probably damaging Het
Rskr T C 11: 78,183,573 (GRCm39) F194L probably benign Het
Semp2l1 A T 1: 32,584,729 (GRCm39) C394S probably damaging Het
Sh3pxd2a T C 19: 47,261,850 (GRCm39) N315S possibly damaging Het
Snph T C 2: 151,436,464 (GRCm39) I86V probably damaging Het
Sox6 A G 7: 115,376,463 (GRCm39) Y90H probably damaging Het
Tbc1d13 T A 2: 30,032,323 (GRCm39) C145S probably benign Het
Tcp11l1 T C 2: 104,530,289 (GRCm39) E65G probably damaging Het
Thrb G T 14: 18,011,181 (GRCm38) E186* probably null Het
Tmem101 A G 11: 102,047,059 (GRCm39) Y38H possibly damaging Het
Trarg1 T A 11: 76,571,134 (GRCm39) L50Q probably damaging Het
Urb1 A T 16: 90,580,162 (GRCm39) probably null Het
Usp10 G A 8: 120,683,420 (GRCm39) V764I possibly damaging Het
Usp25 A G 16: 76,906,115 (GRCm39) E857G probably benign Het
Vmn1r17 A G 6: 57,337,828 (GRCm39) V130A probably benign Het
Wdr35 T C 12: 9,068,142 (GRCm39) L775P probably damaging Het
Xpnpep1 T C 19: 53,001,845 (GRCm39) T134A probably benign Het
Zbtb10 T C 3: 9,329,731 (GRCm39) V363A probably damaging Het
Zfp108 G T 7: 23,960,163 (GRCm39) K251N probably benign Het
Other mutations in Or8g17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01533:Or8g17 APN 9 38,930,097 (GRCm39) missense probably damaging 0.98
IGL01655:Or8g17 APN 9 38,930,214 (GRCm39) missense probably benign 0.00
IGL01804:Or8g17 APN 9 38,930,697 (GRCm39) missense probably benign 0.13
IGL02098:Or8g17 APN 9 38,930,187 (GRCm39) missense probably damaging 1.00
IGL02719:Or8g17 APN 9 38,930,312 (GRCm39) missense probably benign 0.11
R0531:Or8g17 UTSW 9 38,930,472 (GRCm39) missense probably damaging 0.97
R1270:Or8g17 UTSW 9 38,930,543 (GRCm39) missense possibly damaging 0.90
R1511:Or8g17 UTSW 9 38,930,321 (GRCm39) missense probably benign 0.03
R1590:Or8g17 UTSW 9 38,930,253 (GRCm39) missense probably benign 0.09
R1649:Or8g17 UTSW 9 38,930,776 (GRCm39) missense probably benign 0.03
R3419:Or8g17 UTSW 9 38,930,372 (GRCm39) missense probably benign 0.03
R4669:Or8g17 UTSW 9 38,930,675 (GRCm39) missense probably benign 0.10
R4788:Or8g17 UTSW 9 38,930,217 (GRCm39) missense probably benign 0.07
R5581:Or8g17 UTSW 9 38,929,998 (GRCm39) missense probably damaging 0.98
R6032:Or8g17 UTSW 9 38,930,261 (GRCm39) missense probably benign 0.00
R6032:Or8g17 UTSW 9 38,930,261 (GRCm39) missense probably benign 0.00
R6319:Or8g17 UTSW 9 38,930,810 (GRCm39) missense probably damaging 1.00
R6626:Or8g17 UTSW 9 38,930,402 (GRCm39) missense possibly damaging 0.63
R6693:Or8g17 UTSW 9 38,930,097 (GRCm39) missense probably damaging 0.98
R7165:Or8g17 UTSW 9 38,934,566 (GRCm39) start gained probably benign
R7947:Or8g17 UTSW 9 38,930,747 (GRCm39) missense probably damaging 0.99
R7957:Or8g17 UTSW 9 38,930,349 (GRCm39) missense probably benign
R8052:Or8g17 UTSW 9 38,930,783 (GRCm39) missense probably damaging 0.99
R8162:Or8g17 UTSW 9 38,930,249 (GRCm39) missense probably benign 0.01
R9004:Or8g17 UTSW 9 38,930,580 (GRCm39) missense probably benign 0.01
R9083:Or8g17 UTSW 9 38,930,016 (GRCm39) missense probably damaging 1.00
R9584:Or8g17 UTSW 9 38,930,462 (GRCm39) missense probably damaging 1.00
Z1088:Or8g17 UTSW 9 38,930,085 (GRCm39) missense probably damaging 1.00
Z1191:Or8g17 UTSW 9 38,930,229 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCAATGACTCCCAAGAAG -3'
(R):5'- TATCAGCATCCTACGCATTAAATCC -3'

Sequencing Primer
(F):5'- TGACTCCCAAGAAGAAGATGTG -3'
(R):5'- TACGCATTAAATCCACTGAGGG -3'
Posted On 2016-07-06