Incidental Mutation 'R5184:Flnb'
ID397770
Institutional Source Beutler Lab
Gene Symbol Flnb
Ensembl Gene ENSMUSG00000025278
Gene Namefilamin, beta
Synonyms
MMRRC Submission 042763-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5184 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location7817957-7951588 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 7901945 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 936 (V936E)
Ref Sequence ENSEMBL: ENSMUSP00000052020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052678]
Predicted Effect probably damaging
Transcript: ENSMUST00000052678
AA Change: V936E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052020
Gene: ENSMUSG00000025278
AA Change: V936E

DomainStartEndE-ValueType
CH 18 120 2.38e-26 SMART
CH 141 237 1.83e-18 SMART
IG_FLMN 253 350 1.17e-33 SMART
IG_FLMN 353 449 2.08e-34 SMART
IG_FLMN 451 546 3.42e-35 SMART
IG_FLMN 548 639 6.06e-27 SMART
IG_FLMN 644 739 1.94e-34 SMART
IG_FLMN 741 842 4.25e-31 SMART
IG_FLMN 844 941 5.16e-30 SMART
IG_FLMN 943 1037 5.12e-25 SMART
IG_FLMN 1039 1130 5.31e-41 SMART
IG_FLMN 1132 1225 1.4e-31 SMART
IG_FLMN 1227 1325 1.42e-32 SMART
IG_FLMN 1327 1418 5.19e-35 SMART
IG_FLMN 1420 1514 2.48e-41 SMART
IG_FLMN 1516 1611 3.15e-34 SMART
IG_FLMN 1613 1707 4.99e-37 SMART
IG_FLMN 1730 1819 4.44e-11 SMART
IG_FLMN 1820 1911 5.82e-38 SMART
IG_FLMN 1914 1997 5.68e-9 SMART
IG_FLMN 2001 2092 4.45e-34 SMART
IG_FLMN 2101 2188 1.24e-9 SMART
IG_FLMN 2192 2283 4.48e-39 SMART
IG_FLMN 2286 2378 2.94e-25 SMART
IG_FLMN 2383 2474 5.66e-27 SMART
IG_FLMN 2511 2602 1.63e-27 SMART
Meta Mutation Damage Score 0.9436 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the filamin family. The encoded protein interacts with glycoprotein Ib alpha as part of the process to repair vascular injuries. The platelet glycoprotein Ib complex includes glycoprotein Ib alpha, and it binds the actin cytoskeleton. Mutations in this gene have been found in several conditions: atelosteogenesis type 1 and type 3; boomerang dysplasia; autosomal dominant Larsen syndrome; and spondylocarpotarsal synostosis syndrome. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mutations in this gene cause skeletal defects including runting, premature mineralization, and bone fusion. Nullizygous mice show a delay and reduction in long bone growth. Truncation mutations cause early fusion of spinal vertebrae due to enhanced chondrocyte hypertrophy and early differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aph1a T A 3: 95,895,739 probably null Het
Arid3a A G 10: 79,950,769 E452G possibly damaging Het
Barhl2 A G 5: 106,457,640 S68P unknown Het
BC030499 T C 11: 78,292,747 F194L probably benign Het
Carf T C 1: 60,108,174 S17P probably damaging Het
Ccdc90b A G 7: 92,574,811 D145G probably damaging Het
Cyp7a1 A T 4: 6,271,207 N316K probably benign Het
Daam2 A G 17: 49,494,391 I106T possibly damaging Het
Dmtf1 A G 5: 9,126,641 V437A probably benign Het
E2f2 A T 4: 136,184,440 Y254F possibly damaging Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Ern2 T C 7: 122,179,959 T221A probably benign Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fermt1 A G 2: 132,941,963 V42A possibly damaging Het
Fgf3 A G 7: 144,842,810 D187G probably damaging Het
Gm5415 A T 1: 32,545,648 C394S probably damaging Het
Herc2 T C 7: 56,122,351 Y1093H probably damaging Het
Invs A G 4: 48,283,242 probably benign Het
Katnb1 T A 8: 95,097,980 I534N possibly damaging Het
Kcnq5 A T 1: 21,402,487 D826E probably damaging Het
Klra9 A T 6: 130,188,712 N113K probably benign Het
Knl1 A G 2: 119,069,176 K453E probably damaging Het
Lgi4 C T 7: 31,070,757 probably benign Het
Lpin3 A G 2: 160,897,138 S289G probably benign Het
Mapre1 T A 2: 153,758,067 V137E possibly damaging Het
Mark4 A G 7: 19,447,243 F144L possibly damaging Het
Mogat2 G T 7: 99,223,635 A114E possibly damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Nell2 A G 15: 95,527,809 L19P possibly damaging Het
Nfia A T 4: 97,783,348 K98N probably damaging Het
Nutm1 T A 2: 112,249,000 T857S possibly damaging Het
Olfr146 T A 9: 39,018,702 I280F probably damaging Het
Olfr298 TG T 7: 86,489,291 probably null Het
Olfr68 T C 7: 103,777,404 K314E probably benign Het
Pde10a T C 17: 8,977,155 L706P probably damaging Het
Penk A G 4: 4,134,296 L117P probably damaging Het
Pgap1 A G 1: 54,481,856 S876P probably damaging Het
Pmfbp1 T C 8: 109,527,767 I478T possibly damaging Het
Pole G A 5: 110,294,934 E318K possibly damaging Het
Prr12 C A 7: 45,046,377 V1222L unknown Het
Prune2 T C 19: 17,216,357 S3070P possibly damaging Het
Rnf19a A G 15: 36,244,196 C573R probably benign Het
Rp1l1 T C 14: 64,030,180 S1072P probably damaging Het
Sh3pxd2a T C 19: 47,273,411 N315S possibly damaging Het
Snph T C 2: 151,594,544 I86V probably damaging Het
Sox6 A G 7: 115,777,228 Y90H probably damaging Het
Tbc1d13 T A 2: 30,142,311 C145S probably benign Het
Tcp11l1 T C 2: 104,699,944 E65G probably damaging Het
Thrb G T 14: 18,011,181 E186* probably null Het
Tmem101 A G 11: 102,156,233 Y38H possibly damaging Het
Tusc5 T A 11: 76,680,308 L50Q probably damaging Het
Urb1 A T 16: 90,783,274 probably null Het
Usp10 G A 8: 119,956,681 V764I possibly damaging Het
Usp25 A G 16: 77,109,227 E857G probably benign Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Wdr35 T C 12: 9,018,142 L775P probably damaging Het
Xpnpep1 T C 19: 53,013,414 T134A probably benign Het
Zbtb10 T C 3: 9,264,671 V363A probably damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Other mutations in Flnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Flnb APN 14 7917390 splice site probably benign
IGL01063:Flnb APN 14 7926518 splice site probably benign
IGL01135:Flnb APN 14 7909736 missense probably benign
IGL01139:Flnb APN 14 7945989 missense probably damaging 1.00
IGL01364:Flnb APN 14 7934562 critical splice acceptor site probably null
IGL01417:Flnb APN 14 7905513 missense probably damaging 0.99
IGL01505:Flnb APN 14 7902003 critical splice donor site probably null
IGL01560:Flnb APN 14 7893829 missense probably benign 0.07
IGL01621:Flnb APN 14 7950470 missense probably damaging 1.00
IGL01656:Flnb APN 14 7902010 splice site probably benign
IGL01889:Flnb APN 14 7935967 missense possibly damaging 0.85
IGL01987:Flnb APN 14 7922748 critical splice donor site probably null
IGL02322:Flnb APN 14 7894676 missense probably damaging 1.00
IGL02496:Flnb APN 14 7930919 splice site probably benign
IGL02752:Flnb APN 14 7917338 missense probably benign
IGL03001:Flnb APN 14 7934680 missense probably damaging 0.99
IGL03076:Flnb APN 14 7901988 missense probably benign 0.01
IGL03085:Flnb APN 14 7882211 missense probably benign
IGL03170:Flnb APN 14 7818261 missense possibly damaging 0.90
IGL03373:Flnb APN 14 7890867 critical splice donor site probably null
R0068:Flnb UTSW 14 7915290 missense possibly damaging 0.49
R0068:Flnb UTSW 14 7915290 missense possibly damaging 0.49
R0084:Flnb UTSW 14 7935979 missense probably benign
R0128:Flnb UTSW 14 7901951 missense probably damaging 0.99
R0130:Flnb UTSW 14 7901951 missense probably damaging 0.99
R0148:Flnb UTSW 14 7939077 missense probably benign 0.01
R0166:Flnb UTSW 14 7896115 missense probably damaging 1.00
R0376:Flnb UTSW 14 7946014 critical splice donor site probably null
R0547:Flnb UTSW 14 7912943 splice site probably null
R0612:Flnb UTSW 14 7887682 splice site probably benign
R0656:Flnb UTSW 14 7927352 missense probably damaging 1.00
R0691:Flnb UTSW 14 7890810 missense probably benign 0.16
R1241:Flnb UTSW 14 7896503 missense probably benign 0.06
R1572:Flnb UTSW 14 7883908 missense probably damaging 0.97
R1682:Flnb UTSW 14 7913121 missense probably benign 0.04
R1807:Flnb UTSW 14 7934645 missense probably benign 0.26
R1848:Flnb UTSW 14 7892113 missense probably damaging 1.00
R1959:Flnb UTSW 14 7884735 nonsense probably null
R2078:Flnb UTSW 14 7927466 missense probably damaging 1.00
R2132:Flnb UTSW 14 7873376 missense probably benign 0.04
R2209:Flnb UTSW 14 7905507 nonsense probably null
R2212:Flnb UTSW 14 7881652 small deletion probably benign
R2213:Flnb UTSW 14 7881652 small deletion probably benign
R2363:Flnb UTSW 14 7945950 missense possibly damaging 0.95
R2415:Flnb UTSW 14 7929932 missense probably benign 0.07
R2983:Flnb UTSW 14 7882250 missense probably damaging 1.00
R3001:Flnb UTSW 14 7907162 missense probably benign 0.22
R3002:Flnb UTSW 14 7907162 missense probably benign 0.22
R3436:Flnb UTSW 14 7942057 missense probably damaging 0.97
R3437:Flnb UTSW 14 7942057 missense probably damaging 0.97
R3778:Flnb UTSW 14 7915353 missense probably benign 0.06
R3783:Flnb UTSW 14 7889236 missense probably benign 0.04
R4162:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4163:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4164:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4356:Flnb UTSW 14 7922700 missense probably benign
R4369:Flnb UTSW 14 7942216 missense probably benign
R4783:Flnb UTSW 14 7905701 missense probably benign 0.12
R4785:Flnb UTSW 14 7905701 missense probably benign 0.12
R4790:Flnb UTSW 14 7905661 missense probably benign 0.34
R4828:Flnb UTSW 14 7919238 missense probably benign 0.13
R4882:Flnb UTSW 14 7929936 missense possibly damaging 0.56
R5002:Flnb UTSW 14 7945882 missense probably damaging 1.00
R5058:Flnb UTSW 14 7924262 nonsense probably null
R5186:Flnb UTSW 14 7909748 missense probably damaging 1.00
R5395:Flnb UTSW 14 7883881 missense probably benign 0.02
R5421:Flnb UTSW 14 7926494 missense probably damaging 1.00
R5667:Flnb UTSW 14 7890843 missense probably benign 0.00
R5671:Flnb UTSW 14 7890843 missense probably benign 0.00
R5714:Flnb UTSW 14 7929073 missense probably damaging 1.00
R5860:Flnb UTSW 14 7931135 missense probably damaging 1.00
R5892:Flnb UTSW 14 7907183 missense probably damaging 1.00
R5924:Flnb UTSW 14 7890765 missense probably benign 0.00
R6131:Flnb UTSW 14 7894635 missense possibly damaging 0.79
R6244:Flnb UTSW 14 7892092 missense probably damaging 1.00
R6489:Flnb UTSW 14 7867551 missense probably damaging 1.00
R6582:Flnb UTSW 14 7892275 critical splice donor site probably null
R6586:Flnb UTSW 14 7929138 missense possibly damaging 0.93
R6611:Flnb UTSW 14 7915318 missense probably damaging 1.00
R6626:Flnb UTSW 14 7929012 missense probably damaging 1.00
R6700:Flnb UTSW 14 7892189 missense probably damaging 0.99
R6738:Flnb UTSW 14 7904536 missense probably benign 0.01
R6864:Flnb UTSW 14 7905640 missense possibly damaging 0.84
R6916:Flnb UTSW 14 7907171 missense probably damaging 0.99
R7117:Flnb UTSW 14 7894214 missense probably benign 0.02
R7164:Flnb UTSW 14 7915944 splice site probably null
R7328:Flnb UTSW 14 7883788 missense possibly damaging 0.95
R7328:Flnb UTSW 14 7894660 nonsense probably null
R7687:Flnb UTSW 14 7924224 missense probably damaging 1.00
R7716:Flnb UTSW 14 7917274 missense possibly damaging 0.64
R7763:Flnb UTSW 14 7926478 missense probably benign 0.00
R7821:Flnb UTSW 14 7939113 missense probably benign 0.00
R8008:Flnb UTSW 14 7892155 missense probably damaging 1.00
X0066:Flnb UTSW 14 7908636 missense probably damaging 1.00
Z1088:Flnb UTSW 14 7905871 missense probably benign 0.04
Z1176:Flnb UTSW 14 7942066 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TGTTTCCTGAAGCCAGTAAGAG -3'
(R):5'- TGCAACATCTCTCCAAGGC -3'

Sequencing Primer
(F):5'- GCATTAACTCGGTGTCACAGTAC -3'
(R):5'- CTCCAAGGCAGAATTAGTGTCTCTG -3'
Posted On2016-07-06