Incidental Mutation 'R5184:Thrb'
ID397771
Institutional Source Beutler Lab
Gene Symbol Thrb
Ensembl Gene ENSMUSG00000021779
Gene Namethyroid hormone receptor beta
Synonymsc-erbAbeta, T3R[b], Nr1a2, T3Rbeta, Thrb1, TR beta, Thrb2
MMRRC Submission 042763-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.464) question?
Stock #R5184 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location17660261-18038090 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 18011181 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 186 (E186*)
Ref Sequence ENSEMBL: ENSMUSP00000153355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022303] [ENSMUST00000022304] [ENSMUST00000091471] [ENSMUST00000224934]
Predicted Effect probably null
Transcript: ENSMUST00000022303
AA Change: E217*
SMART Domains Protein: ENSMUSP00000022303
Gene: ENSMUSG00000021779
AA Change: E217*

DomainStartEndE-ValueType
ZnF_C4 104 177 2.88e-36 SMART
low complexity region 188 203 N/A INTRINSIC
HOLI 274 432 9.29e-31 SMART
Predicted Effect probably null
Transcript: ENSMUST00000022304
AA Change: E231*
SMART Domains Protein: ENSMUSP00000022304
Gene: ENSMUSG00000021779
AA Change: E231*

DomainStartEndE-ValueType
ZnF_C4 118 191 2.88e-36 SMART
low complexity region 202 217 N/A INTRINSIC
HOLI 288 446 9.29e-31 SMART
Predicted Effect probably null
Transcript: ENSMUST00000091471
AA Change: E217*
SMART Domains Protein: ENSMUSP00000089053
Gene: ENSMUSG00000021779
AA Change: E217*

DomainStartEndE-ValueType
ZnF_C4 104 177 2.88e-36 SMART
low complexity region 188 203 N/A INTRINSIC
HOLI 274 432 9.29e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224512
Predicted Effect probably null
Transcript: ENSMUST00000224934
AA Change: E186*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225876
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear hormone receptor for triiodothyronine. It is one of the several receptors for thyroid hormone, and has been shown to mediate the biological activities of thyroid hormone. Knockout studies in mice suggest that the different receptors, while having certain extent of redundancy, may mediate different functions of thyroid hormone. Mutations in this gene are known to be a cause of generalized thyroid hormone resistance (GTHR), a syndrome characterized by goiter and high levels of circulating thyroid hormone (T3-T4), with normal or slightly elevated thyroid stimulating hormone (TSH). Several alternatively spliced transcript variants encoding the same protein have been observed for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit elevated T3, T4, and TSH serum levels, abnormal ear morphology, deafness, and abnormal thyroid morphology. Mice homozygous for allele with point mutations exhibit disruption in thyroid hormone sensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aph1a T A 3: 95,895,739 probably null Het
Arid3a A G 10: 79,950,769 E452G possibly damaging Het
Barhl2 A G 5: 106,457,640 S68P unknown Het
BC030499 T C 11: 78,292,747 F194L probably benign Het
Carf T C 1: 60,108,174 S17P probably damaging Het
Ccdc90b A G 7: 92,574,811 D145G probably damaging Het
Cyp7a1 A T 4: 6,271,207 N316K probably benign Het
Daam2 A G 17: 49,494,391 I106T possibly damaging Het
Dmtf1 A G 5: 9,126,641 V437A probably benign Het
E2f2 A T 4: 136,184,440 Y254F possibly damaging Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Ern2 T C 7: 122,179,959 T221A probably benign Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fermt1 A G 2: 132,941,963 V42A possibly damaging Het
Fgf3 A G 7: 144,842,810 D187G probably damaging Het
Flnb T A 14: 7,901,945 V936E probably damaging Het
Gm5415 A T 1: 32,545,648 C394S probably damaging Het
Herc2 T C 7: 56,122,351 Y1093H probably damaging Het
Invs A G 4: 48,283,242 probably benign Het
Katnb1 T A 8: 95,097,980 I534N possibly damaging Het
Kcnq5 A T 1: 21,402,487 D826E probably damaging Het
Klra9 A T 6: 130,188,712 N113K probably benign Het
Knl1 A G 2: 119,069,176 K453E probably damaging Het
Lgi4 C T 7: 31,070,757 probably benign Het
Lpin3 A G 2: 160,897,138 S289G probably benign Het
Mapre1 T A 2: 153,758,067 V137E possibly damaging Het
Mark4 A G 7: 19,447,243 F144L possibly damaging Het
Mogat2 G T 7: 99,223,635 A114E possibly damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Nell2 A G 15: 95,527,809 L19P possibly damaging Het
Nfia A T 4: 97,783,348 K98N probably damaging Het
Nutm1 T A 2: 112,249,000 T857S possibly damaging Het
Olfr146 T A 9: 39,018,702 I280F probably damaging Het
Olfr298 TG T 7: 86,489,291 probably null Het
Olfr68 T C 7: 103,777,404 K314E probably benign Het
Pde10a T C 17: 8,977,155 L706P probably damaging Het
Penk A G 4: 4,134,296 L117P probably damaging Het
Pgap1 A G 1: 54,481,856 S876P probably damaging Het
Pmfbp1 T C 8: 109,527,767 I478T possibly damaging Het
Pole G A 5: 110,294,934 E318K possibly damaging Het
Prr12 C A 7: 45,046,377 V1222L unknown Het
Prune2 T C 19: 17,216,357 S3070P possibly damaging Het
Rnf19a A G 15: 36,244,196 C573R probably benign Het
Rp1l1 T C 14: 64,030,180 S1072P probably damaging Het
Sh3pxd2a T C 19: 47,273,411 N315S possibly damaging Het
Snph T C 2: 151,594,544 I86V probably damaging Het
Sox6 A G 7: 115,777,228 Y90H probably damaging Het
Tbc1d13 T A 2: 30,142,311 C145S probably benign Het
Tcp11l1 T C 2: 104,699,944 E65G probably damaging Het
Tmem101 A G 11: 102,156,233 Y38H possibly damaging Het
Tusc5 T A 11: 76,680,308 L50Q probably damaging Het
Urb1 A T 16: 90,783,274 probably null Het
Usp10 G A 8: 119,956,681 V764I possibly damaging Het
Usp25 A G 16: 77,109,227 E857G probably benign Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Wdr35 T C 12: 9,018,142 L775P probably damaging Het
Xpnpep1 T C 19: 53,013,414 T134A probably benign Het
Zbtb10 T C 3: 9,264,671 V363A probably damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Other mutations in Thrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Thrb APN 14 18011056 splice site probably benign
IGL02488:Thrb APN 14 18033455 missense probably damaging 0.98
IGL02598:Thrb APN 14 18008606 missense possibly damaging 0.95
IGL02707:Thrb APN 14 18026721 missense probably benign 0.42
harry UTSW 14 18011145 nonsense probably null
R0479:Thrb UTSW 14 18033643 missense probably damaging 0.99
R0988:Thrb UTSW 14 17981837 intron probably benign
R1257:Thrb UTSW 14 18008642 missense probably damaging 1.00
R1522:Thrb UTSW 14 18002597 missense probably damaging 1.00
R1927:Thrb UTSW 14 18008674 missense probably damaging 1.00
R2100:Thrb UTSW 14 18030393 missense possibly damaging 0.73
R2134:Thrb UTSW 14 18033487 missense probably benign 0.22
R3551:Thrb UTSW 14 17963214 missense probably damaging 0.99
R3888:Thrb UTSW 14 18033551 missense probably damaging 1.00
R3975:Thrb UTSW 14 18033456 missense probably damaging 1.00
R4294:Thrb UTSW 14 18011145 nonsense probably null
R4371:Thrb UTSW 14 18030275 missense probably damaging 1.00
R4454:Thrb UTSW 14 18011187 missense probably damaging 0.97
R4457:Thrb UTSW 14 18011187 missense probably damaging 0.97
R4486:Thrb UTSW 14 17925640 start codon destroyed probably null 0.72
R4961:Thrb UTSW 14 18011076 missense probably benign 0.39
R5609:Thrb UTSW 14 18033526 missense probably benign 0.22
R6023:Thrb UTSW 14 18011209 missense probably damaging 0.98
R6891:Thrb UTSW 14 17981899 missense probably benign
R7288:Thrb UTSW 14 18030186 missense probably damaging 1.00
R7294:Thrb UTSW 14 17826963 start gained probably benign
R7780:Thrb UTSW 14 18008608 missense possibly damaging 0.73
Z1177:Thrb UTSW 14 18033433 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGGACACTGGACTCATAGTG -3'
(R):5'- AGACTCATGTCAGGAGGGTC -3'

Sequencing Primer
(F):5'- AAAATGTGCCCCGTGTGAC -3'
(R):5'- TCCAGAGGACTCTAAACTTTGGCAG -3'
Posted On2016-07-06