Mutagenetix > Incidental Mutations

Incidental Mutation 'R5184:Thrb'

397771

Institutional Source

Beutler Lab

Gene Symbol

Thrb

Ensembl Gene

ENSMUSG00000021779

Gene Name

thyroid hormone receptor beta

Synonyms

c-erbAbeta, T3R[b], Nr1a2, T3Rbeta, Thrb1, TR beta, Thrb2

MMRRC Submission

042763-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.368) question?

Stock #

R5184 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

17660261-18038090 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 18011181 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 186 (E186*)

Ref Sequence

ENSEMBL: ENSMUSP00000153355 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022303] [ENSMUST00000022304] [ENSMUST00000091471] [ENSMUST00000224934]

Predicted Effect

probably null
Transcript: ENSMUST00000022303
AA Change: E217*

SMART Domains

Protein: ENSMUSP00000022303
Gene: ENSMUSG00000021779
AA Change: E217*

Domain	Start	End	E-Value	Type
ZnF_C4	104	177	2.88e-36	SMART
low complexity region	188	203	N/A	INTRINSIC
HOLI	274	432	9.29e-31	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000022304
AA Change: E231*

SMART Domains

Protein: ENSMUSP00000022304
Gene: ENSMUSG00000021779
AA Change: E231*

Domain	Start	End	E-Value	Type
ZnF_C4	118	191	2.88e-36	SMART
low complexity region	202	217	N/A	INTRINSIC
HOLI	288	446	9.29e-31	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000091471
AA Change: E217*

SMART Domains

Protein: ENSMUSP00000089053
Gene: ENSMUSG00000021779
AA Change: E217*

Domain	Start	End	E-Value	Type
ZnF_C4	104	177	2.88e-36	SMART
low complexity region	188	203	N/A	INTRINSIC
HOLI	274	432	9.29e-31	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224512

Predicted Effect

probably null
Transcript: ENSMUST00000224934
AA Change: E186*

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225876

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.6%

Validation Efficiency

98% (63/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear hormone receptor for triiodothyronine. It is one of the several receptors for thyroid hormone, and has been shown to mediate the biological activities of thyroid hormone. Knockout studies in mice suggest that the different receptors, while having certain extent of redundancy, may mediate different functions of thyroid hormone. Mutations in this gene are known to be a cause of generalized thyroid hormone resistance (GTHR), a syndrome characterized by goiter and high levels of circulating thyroid hormone (T3-T4), with normal or slightly elevated thyroid stimulating hormone (TSH). Several alternatively spliced transcript variants encoding the same protein have been observed for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit elevated T3, T4, and TSH serum levels, abnormal ear morphology, deafness, and abnormal thyroid morphology. Mice homozygous for allele with point mutations exhibit disruption in thyroid hormone sensitivity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aph1a	T	A	3: 95,895,739		probably null	Het
Arid3a	A	G	10: 79,950,769	E452G	possibly damaging	Het
Barhl2	A	G	5: 106,457,640	S68P	unknown	Het
BC030499	T	C	11: 78,292,747	F194L	probably benign	Het
Carf	T	C	1: 60,108,174	S17P	probably damaging	Het
Ccdc90b	A	G	7: 92,574,811	D145G	probably damaging	Het
Cyp7a1	A	T	4: 6,271,207	N316K	probably benign	Het
Daam2	A	G	17: 49,494,391	I106T	possibly damaging	Het
Dmtf1	A	G	5: 9,126,641	V437A	probably benign	Het
E2f2	A	T	4: 136,184,440	Y254F	possibly damaging	Het
Ehmt1	G	T	2: 24,877,497	P135T	probably damaging	Het
Ern2	T	C	7: 122,179,959	T221A	probably benign	Het
Fam227b	G	A	2: 126,116,123	P241S	probably damaging	Het
Fermt1	A	G	2: 132,941,963	V42A	possibly damaging	Het
Fgf3	A	G	7: 144,842,810	D187G	probably damaging	Het
Flnb	T	A	14: 7,901,945	V936E	probably damaging	Het
Gm5415	A	T	1: 32,545,648	C394S	probably damaging	Het
Herc2	T	C	7: 56,122,351	Y1093H	probably damaging	Het
Invs	A	G	4: 48,283,242		probably benign	Het
Katnb1	T	A	8: 95,097,980	I534N	possibly damaging	Het
Kcnq5	A	T	1: 21,402,487	D826E	probably damaging	Het
Klra9	A	T	6: 130,188,712	N113K	probably benign	Het
Knl1	A	G	2: 119,069,176	K453E	probably damaging	Het
Lgi4	C	T	7: 31,070,757		probably benign	Het
Lpin3	A	G	2: 160,897,138	S289G	probably benign	Het
Mapre1	T	A	2: 153,758,067	V137E	possibly damaging	Het
Mark4	A	G	7: 19,447,243	F144L	possibly damaging	Het
Mogat2	G	T	7: 99,223,635	A114E	possibly damaging	Het
Msh2	C	A	17: 87,723,413	A906E	probably benign	Het
Nell2	A	G	15: 95,527,809	L19P	possibly damaging	Het
Nfia	A	T	4: 97,783,348	K98N	probably damaging	Het
Nutm1	T	A	2: 112,249,000	T857S	possibly damaging	Het
Olfr146	T	A	9: 39,018,702	I280F	probably damaging	Het
Olfr298	TG	T	7: 86,489,291		probably null	Het
Olfr68	T	C	7: 103,777,404	K314E	probably benign	Het
Pde10a	T	C	17: 8,977,155	L706P	probably damaging	Het
Penk	A	G	4: 4,134,296	L117P	probably damaging	Het
Pgap1	A	G	1: 54,481,856	S876P	probably damaging	Het
Pmfbp1	T	C	8: 109,527,767	I478T	possibly damaging	Het
Pole	G	A	5: 110,294,934	E318K	possibly damaging	Het
Prr12	C	A	7: 45,046,377	V1222L	unknown	Het
Prune2	T	C	19: 17,216,357	S3070P	possibly damaging	Het
Rnf19a	A	G	15: 36,244,196	C573R	probably benign	Het
Rp1l1	T	C	14: 64,030,180	S1072P	probably damaging	Het
Sh3pxd2a	T	C	19: 47,273,411	N315S	possibly damaging	Het
Snph	T	C	2: 151,594,544	I86V	probably damaging	Het
Sox6	A	G	7: 115,777,228	Y90H	probably damaging	Het
Tbc1d13	T	A	2: 30,142,311	C145S	probably benign	Het
Tcp11l1	T	C	2: 104,699,944	E65G	probably damaging	Het
Tmem101	A	G	11: 102,156,233	Y38H	possibly damaging	Het
Tusc5	T	A	11: 76,680,308	L50Q	probably damaging	Het
Urb1	A	T	16: 90,783,274		probably null	Het
Usp10	G	A	8: 119,956,681	V764I	possibly damaging	Het
Usp25	A	G	16: 77,109,227	E857G	probably benign	Het
Vmn1r17	A	G	6: 57,360,843	V130A	probably benign	Het
Wdr35	T	C	12: 9,018,142	L775P	probably damaging	Het
Xpnpep1	T	C	19: 53,013,414	T134A	probably benign	Het
Zbtb10	T	C	3: 9,264,671	V363A	probably damaging	Het
Zfp108	G	T	7: 24,260,738	K251N	probably benign	Het

Other mutations in Thrb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01302:Thrb	APN	14	18011056	splice site	probably benign
IGL02488:Thrb	APN	14	18033455	missense	probably damaging	0.98
IGL02598:Thrb	APN	14	18008606	missense	possibly damaging	0.95
IGL02707:Thrb	APN	14	18026721	missense	probably benign	0.42
harry	UTSW	14	18011145	nonsense	probably null
R0479:Thrb	UTSW	14	18033643	missense	probably damaging	0.99
R0988:Thrb	UTSW	14	17981837	intron	probably benign
R1257:Thrb	UTSW	14	18008642	missense	probably damaging	1.00
R1522:Thrb	UTSW	14	18002597	missense	probably damaging	1.00
R1927:Thrb	UTSW	14	18008674	missense	probably damaging	1.00
R2100:Thrb	UTSW	14	18030393	missense	possibly damaging	0.73
R2134:Thrb	UTSW	14	18033487	missense	probably benign	0.22
R3551:Thrb	UTSW	14	17963214	missense	probably damaging	0.99
R3888:Thrb	UTSW	14	18033551	missense	probably damaging	1.00
R3975:Thrb	UTSW	14	18033456	missense	probably damaging	1.00
R4294:Thrb	UTSW	14	18011145	nonsense	probably null
R4371:Thrb	UTSW	14	18030275	missense	probably damaging	1.00
R4454:Thrb	UTSW	14	18011187	missense	probably damaging	0.97
R4457:Thrb	UTSW	14	18011187	missense	probably damaging	0.97
R4486:Thrb	UTSW	14	17925640	start codon destroyed	probably null	0.72
R4961:Thrb	UTSW	14	18011076	missense	probably benign	0.39
R5609:Thrb	UTSW	14	18033526	missense	probably benign	0.22
R6023:Thrb	UTSW	14	18011209	missense	probably damaging	0.98
R6891:Thrb	UTSW	14	17981899	missense	probably benign
R7288:Thrb	UTSW	14	18030186	missense	probably damaging	1.00
R7294:Thrb	UTSW	14	17826963	start gained	probably benign
R7780:Thrb	UTSW	14	18008608	missense	possibly damaging	0.73
R8098:Thrb	UTSW	14	18008645	missense	probably damaging	1.00
Z1177:Thrb	UTSW	14	18033433	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTGGACACTGGACTCATAGTG -3'
(R):5'- AGACTCATGTCAGGAGGGTC -3'

Sequencing Primer
(F):5'- AAAATGTGCCCCGTGTGAC -3'
(R):5'- TCCAGAGGACTCTAAACTTTGGCAG -3'

Posted On

2016-07-06