Incidental Mutation 'R5184:Urb1'
ID 397776
Institutional Source Beutler Lab
Gene Symbol Urb1
Ensembl Gene ENSMUSG00000039929
Gene Name URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Synonyms 5730405K23Rik, 4921511H13Rik
MMRRC Submission 042763-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5184 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 90548415-90607301 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 90580162 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140920]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000140920
SMART Domains Protein: ENSMUSP00000114717
Gene: ENSMUSG00000039929

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:Npa1 78 396 1.5e-86 PFAM
low complexity region 751 761 N/A INTRINSIC
low complexity region 955 966 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
low complexity region 1360 1375 N/A INTRINSIC
Pfam:NopRA1 1670 1859 3.6e-60 PFAM
low complexity region 2029 2040 N/A INTRINSIC
low complexity region 2092 2111 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142955
Meta Mutation Damage Score 0.9591 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aph1a T A 3: 95,803,051 (GRCm39) probably null Het
Arid3a A G 10: 79,786,603 (GRCm39) E452G possibly damaging Het
Barhl2 A G 5: 106,605,506 (GRCm39) S68P unknown Het
Carf T C 1: 60,147,333 (GRCm39) S17P probably damaging Het
Ccdc90b A G 7: 92,224,019 (GRCm39) D145G probably damaging Het
Cyp7a1 A T 4: 6,271,207 (GRCm39) N316K probably benign Het
Daam2 A G 17: 49,801,419 (GRCm39) I106T possibly damaging Het
Dmtf1 A G 5: 9,176,641 (GRCm39) V437A probably benign Het
E2f2 A T 4: 135,911,751 (GRCm39) Y254F possibly damaging Het
Ehmt1 G T 2: 24,767,509 (GRCm39) P135T probably damaging Het
Ern2 T C 7: 121,779,182 (GRCm39) T221A probably benign Het
Fam227b G A 2: 125,958,043 (GRCm39) P241S probably damaging Het
Fermt1 A G 2: 132,783,883 (GRCm39) V42A possibly damaging Het
Fgf3 A G 7: 144,396,547 (GRCm39) D187G probably damaging Het
Flnb T A 14: 7,901,945 (GRCm38) V936E probably damaging Het
Herc2 T C 7: 55,772,099 (GRCm39) Y1093H probably damaging Het
Invs A G 4: 48,283,242 (GRCm39) probably benign Het
Katnb1 T A 8: 95,824,608 (GRCm39) I534N possibly damaging Het
Kcnq5 A T 1: 21,472,711 (GRCm39) D826E probably damaging Het
Klra9 A T 6: 130,165,675 (GRCm39) N113K probably benign Het
Knl1 A G 2: 118,899,657 (GRCm39) K453E probably damaging Het
Lgi4 C T 7: 30,770,182 (GRCm39) probably benign Het
Lpin3 A G 2: 160,739,058 (GRCm39) S289G probably benign Het
Mapre1 T A 2: 153,599,987 (GRCm39) V137E possibly damaging Het
Mark4 A G 7: 19,181,168 (GRCm39) F144L possibly damaging Het
Mogat2 G T 7: 98,872,842 (GRCm39) A114E possibly damaging Het
Msh2 C A 17: 88,030,841 (GRCm39) A906E probably benign Het
Nell2 A G 15: 95,425,690 (GRCm39) L19P possibly damaging Het
Nfia A T 4: 97,671,585 (GRCm39) K98N probably damaging Het
Nutm1 T A 2: 112,079,345 (GRCm39) T857S possibly damaging Het
Or14a257 TG T 7: 86,138,499 (GRCm39) probably null Het
Or52a5 T C 7: 103,426,611 (GRCm39) K314E probably benign Het
Or8g17 T A 9: 38,929,998 (GRCm39) I280F probably damaging Het
Pde10a T C 17: 9,195,987 (GRCm39) L706P probably damaging Het
Penk A G 4: 4,134,296 (GRCm39) L117P probably damaging Het
Pgap1 A G 1: 54,521,015 (GRCm39) S876P probably damaging Het
Pmfbp1 T C 8: 110,254,399 (GRCm39) I478T possibly damaging Het
Pole G A 5: 110,442,800 (GRCm39) E318K possibly damaging Het
Prr12 C A 7: 44,695,801 (GRCm39) V1222L unknown Het
Prune2 T C 19: 17,193,721 (GRCm39) S3070P possibly damaging Het
Rnf19a A G 15: 36,244,342 (GRCm39) C573R probably benign Het
Rp1l1 T C 14: 64,267,629 (GRCm39) S1072P probably damaging Het
Rskr T C 11: 78,183,573 (GRCm39) F194L probably benign Het
Semp2l1 A T 1: 32,584,729 (GRCm39) C394S probably damaging Het
Sh3pxd2a T C 19: 47,261,850 (GRCm39) N315S possibly damaging Het
Snph T C 2: 151,436,464 (GRCm39) I86V probably damaging Het
Sox6 A G 7: 115,376,463 (GRCm39) Y90H probably damaging Het
Tbc1d13 T A 2: 30,032,323 (GRCm39) C145S probably benign Het
Tcp11l1 T C 2: 104,530,289 (GRCm39) E65G probably damaging Het
Thrb G T 14: 18,011,181 (GRCm38) E186* probably null Het
Tmem101 A G 11: 102,047,059 (GRCm39) Y38H possibly damaging Het
Trarg1 T A 11: 76,571,134 (GRCm39) L50Q probably damaging Het
Usp10 G A 8: 120,683,420 (GRCm39) V764I possibly damaging Het
Usp25 A G 16: 76,906,115 (GRCm39) E857G probably benign Het
Vmn1r17 A G 6: 57,337,828 (GRCm39) V130A probably benign Het
Wdr35 T C 12: 9,068,142 (GRCm39) L775P probably damaging Het
Xpnpep1 T C 19: 53,001,845 (GRCm39) T134A probably benign Het
Zbtb10 T C 3: 9,329,731 (GRCm39) V363A probably damaging Het
Zfp108 G T 7: 23,960,163 (GRCm39) K251N probably benign Het
Other mutations in Urb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Urb1 APN 16 90,550,209 (GRCm39) critical splice donor site probably null
IGL00915:Urb1 APN 16 90,575,986 (GRCm39) missense possibly damaging 0.76
IGL01108:Urb1 APN 16 90,589,702 (GRCm39) missense probably damaging 1.00
IGL01122:Urb1 APN 16 90,601,346 (GRCm39) missense possibly damaging 0.81
IGL01387:Urb1 APN 16 90,554,649 (GRCm39) missense possibly damaging 0.64
IGL01484:Urb1 APN 16 90,574,448 (GRCm39) missense probably benign 0.11
IGL01606:Urb1 APN 16 90,557,347 (GRCm39) missense probably damaging 1.00
IGL01989:Urb1 APN 16 90,566,474 (GRCm39) splice site probably benign
IGL02516:Urb1 APN 16 90,569,583 (GRCm39) missense possibly damaging 0.49
IGL03018:Urb1 APN 16 90,585,044 (GRCm39) missense probably benign 0.02
IGL03165:Urb1 APN 16 90,577,192 (GRCm39) missense probably damaging 1.00
IGL03216:Urb1 APN 16 90,585,002 (GRCm39) missense probably benign 0.00
H8562:Urb1 UTSW 16 90,566,357 (GRCm39) missense probably benign 0.08
H8786:Urb1 UTSW 16 90,566,357 (GRCm39) missense probably benign 0.08
R0064:Urb1 UTSW 16 90,576,028 (GRCm39) missense probably benign
R0064:Urb1 UTSW 16 90,576,028 (GRCm39) missense probably benign
R0359:Urb1 UTSW 16 90,588,048 (GRCm39) missense probably damaging 1.00
R0386:Urb1 UTSW 16 90,593,287 (GRCm39) missense probably damaging 1.00
R0508:Urb1 UTSW 16 90,580,150 (GRCm39) splice site probably benign
R0517:Urb1 UTSW 16 90,574,310 (GRCm39) nonsense probably null
R0704:Urb1 UTSW 16 90,573,095 (GRCm39) missense probably benign 0.31
R0755:Urb1 UTSW 16 90,576,026 (GRCm39) missense probably benign
R0755:Urb1 UTSW 16 90,570,982 (GRCm39) missense probably damaging 1.00
R0783:Urb1 UTSW 16 90,607,185 (GRCm39) missense possibly damaging 0.55
R0833:Urb1 UTSW 16 90,592,336 (GRCm39) missense possibly damaging 0.89
R0836:Urb1 UTSW 16 90,592,336 (GRCm39) missense possibly damaging 0.89
R0970:Urb1 UTSW 16 90,566,335 (GRCm39) missense possibly damaging 0.83
R1144:Urb1 UTSW 16 90,573,206 (GRCm39) splice site probably null
R1344:Urb1 UTSW 16 90,566,354 (GRCm39) missense probably damaging 1.00
R1418:Urb1 UTSW 16 90,566,354 (GRCm39) missense probably damaging 1.00
R1453:Urb1 UTSW 16 90,593,380 (GRCm39) missense probably damaging 1.00
R1470:Urb1 UTSW 16 90,548,902 (GRCm39) missense probably benign 0.34
R1470:Urb1 UTSW 16 90,548,902 (GRCm39) missense probably benign 0.34
R1520:Urb1 UTSW 16 90,571,633 (GRCm39) missense probably benign 0.00
R1521:Urb1 UTSW 16 90,550,751 (GRCm39) missense probably damaging 1.00
R1598:Urb1 UTSW 16 90,574,328 (GRCm39) missense possibly damaging 0.93
R1617:Urb1 UTSW 16 90,557,340 (GRCm39) missense possibly damaging 0.82
R1625:Urb1 UTSW 16 90,570,936 (GRCm39) critical splice donor site probably null
R1640:Urb1 UTSW 16 90,569,514 (GRCm39) missense probably benign 0.00
R1664:Urb1 UTSW 16 90,584,970 (GRCm39) critical splice donor site probably null
R1672:Urb1 UTSW 16 90,584,285 (GRCm39) missense probably damaging 1.00
R1694:Urb1 UTSW 16 90,563,928 (GRCm39) missense probably benign
R1856:Urb1 UTSW 16 90,558,583 (GRCm39) missense probably benign 0.00
R2001:Urb1 UTSW 16 90,559,232 (GRCm39) missense probably benign 0.30
R2196:Urb1 UTSW 16 90,571,144 (GRCm39) missense probably benign 0.01
R2850:Urb1 UTSW 16 90,571,144 (GRCm39) missense probably benign 0.01
R3009:Urb1 UTSW 16 90,571,686 (GRCm39) missense probably benign 0.09
R3104:Urb1 UTSW 16 90,592,331 (GRCm39) missense probably damaging 1.00
R3105:Urb1 UTSW 16 90,592,331 (GRCm39) missense probably damaging 1.00
R3106:Urb1 UTSW 16 90,592,331 (GRCm39) missense probably damaging 1.00
R3160:Urb1 UTSW 16 90,594,791 (GRCm39) missense probably damaging 1.00
R3162:Urb1 UTSW 16 90,594,791 (GRCm39) missense probably damaging 1.00
R3900:Urb1 UTSW 16 90,580,264 (GRCm39) missense possibly damaging 0.86
R4014:Urb1 UTSW 16 90,566,353 (GRCm39) missense probably damaging 1.00
R4036:Urb1 UTSW 16 90,584,974 (GRCm39) missense probably benign
R4332:Urb1 UTSW 16 90,571,425 (GRCm39) missense probably damaging 1.00
R4448:Urb1 UTSW 16 90,566,282 (GRCm39) missense possibly damaging 0.71
R4581:Urb1 UTSW 16 90,585,034 (GRCm39) missense probably benign 0.04
R4593:Urb1 UTSW 16 90,584,332 (GRCm39) missense probably damaging 1.00
R4610:Urb1 UTSW 16 90,573,159 (GRCm39) missense probably benign 0.43
R4659:Urb1 UTSW 16 90,573,017 (GRCm39) missense probably damaging 0.96
R4672:Urb1 UTSW 16 90,569,522 (GRCm39) missense probably benign
R4681:Urb1 UTSW 16 90,601,425 (GRCm39) missense probably damaging 0.99
R4771:Urb1 UTSW 16 90,550,406 (GRCm39) missense probably benign 0.00
R4790:Urb1 UTSW 16 90,566,443 (GRCm39) nonsense probably null
R4798:Urb1 UTSW 16 90,554,715 (GRCm39) missense probably benign 0.12
R4809:Urb1 UTSW 16 90,556,730 (GRCm39) missense possibly damaging 0.82
R4850:Urb1 UTSW 16 90,592,302 (GRCm39) nonsense probably null
R4916:Urb1 UTSW 16 90,580,216 (GRCm39) missense probably damaging 1.00
R4969:Urb1 UTSW 16 90,602,299 (GRCm39) missense probably damaging 1.00
R5032:Urb1 UTSW 16 90,553,059 (GRCm39) missense probably benign 0.00
R5111:Urb1 UTSW 16 90,548,905 (GRCm39) missense probably benign 0.00
R5122:Urb1 UTSW 16 90,548,983 (GRCm39) nonsense probably null
R5199:Urb1 UTSW 16 90,589,636 (GRCm39) missense possibly damaging 0.95
R5436:Urb1 UTSW 16 90,589,650 (GRCm39) missense probably damaging 1.00
R5767:Urb1 UTSW 16 90,573,051 (GRCm39) missense probably benign 0.00
R5812:Urb1 UTSW 16 90,601,425 (GRCm39) missense probably damaging 0.99
R5872:Urb1 UTSW 16 90,569,652 (GRCm39) nonsense probably null
R6052:Urb1 UTSW 16 90,559,271 (GRCm39) missense probably damaging 1.00
R6063:Urb1 UTSW 16 90,585,985 (GRCm39) missense probably benign 0.02
R6065:Urb1 UTSW 16 90,600,220 (GRCm39) missense probably benign 0.03
R6181:Urb1 UTSW 16 90,575,982 (GRCm39) missense probably benign 0.00
R6268:Urb1 UTSW 16 90,550,807 (GRCm39) missense probably benign 0.03
R6429:Urb1 UTSW 16 90,559,318 (GRCm39) splice site probably null
R6572:Urb1 UTSW 16 90,584,302 (GRCm39) missense probably benign 0.37
R6606:Urb1 UTSW 16 90,607,156 (GRCm39) missense probably benign 0.00
R6730:Urb1 UTSW 16 90,575,971 (GRCm39) missense possibly damaging 0.89
R6838:Urb1 UTSW 16 90,578,994 (GRCm39) missense possibly damaging 0.93
R7237:Urb1 UTSW 16 90,588,054 (GRCm39) missense probably damaging 1.00
R7238:Urb1 UTSW 16 90,549,003 (GRCm39) missense possibly damaging 0.88
R7339:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7341:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7361:Urb1 UTSW 16 90,571,656 (GRCm39) missense probably damaging 0.99
R7365:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7366:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7440:Urb1 UTSW 16 90,584,296 (GRCm39) missense probably damaging 1.00
R7530:Urb1 UTSW 16 90,558,522 (GRCm39) missense probably damaging 1.00
R7553:Urb1 UTSW 16 90,589,752 (GRCm39) missense probably damaging 1.00
R7557:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7603:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7607:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7609:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7610:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7612:Urb1 UTSW 16 90,594,798 (GRCm39) missense probably damaging 1.00
R7613:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7684:Urb1 UTSW 16 90,583,006 (GRCm39) nonsense probably null
R8029:Urb1 UTSW 16 90,576,040 (GRCm39) missense possibly damaging 0.67
R8324:Urb1 UTSW 16 90,588,078 (GRCm39) missense probably damaging 1.00
R8680:Urb1 UTSW 16 90,571,513 (GRCm39) missense probably benign 0.00
R8785:Urb1 UTSW 16 90,600,311 (GRCm39) missense probably benign 0.07
R8914:Urb1 UTSW 16 90,607,122 (GRCm39) missense probably damaging 1.00
R8959:Urb1 UTSW 16 90,571,005 (GRCm39) missense probably benign 0.26
R9005:Urb1 UTSW 16 90,550,678 (GRCm39) missense probably benign 0.01
R9126:Urb1 UTSW 16 90,566,290 (GRCm39) missense possibly damaging 0.53
R9195:Urb1 UTSW 16 90,589,638 (GRCm39) missense probably benign 0.03
R9276:Urb1 UTSW 16 90,569,463 (GRCm39) splice site probably benign
R9534:Urb1 UTSW 16 90,583,096 (GRCm39) missense possibly damaging 0.54
Z1177:Urb1 UTSW 16 90,571,750 (GRCm39) missense probably benign 0.05
Z1177:Urb1 UTSW 16 90,550,771 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAGTGCTAGTCCTGACTGAC -3'
(R):5'- GTAAGTACTGCCCCTTGTCAC -3'

Sequencing Primer
(F):5'- GTGCTAGTCCTGACTGACTTTCATAG -3'
(R):5'- GTCACCTGTGCATATTAACAATTTG -3'
Posted On 2016-07-06