Incidental Mutation 'R5184:Pde10a'
ID 397777
Institutional Source Beutler Lab
Gene Symbol Pde10a
Ensembl Gene ENSMUSG00000023868
Gene Name phosphodiesterase 10A
Synonyms
MMRRC Submission 042763-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5184 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 8744204-9205480 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 9195987 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 706 (L706P)
Ref Sequence ENSEMBL: ENSMUSP00000086485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024647] [ENSMUST00000089085] [ENSMUST00000115708] [ENSMUST00000115715] [ENSMUST00000115717] [ENSMUST00000115720] [ENSMUST00000115724] [ENSMUST00000149440] [ENSMUST00000231430]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000024647
AA Change: L626P

PolyPhen 2 Score 0.745 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000024647
Gene: ENSMUSG00000023868
AA Change: L626P

DomainStartEndE-ValueType
GAF 21 174 1.44e-3 SMART
GAF 196 352 6.56e-29 SMART
HDc 442 608 9.04e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000089085
AA Change: L706P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000086485
Gene: ENSMUSG00000023868
AA Change: L706P

DomainStartEndE-ValueType
GAF 101 254 1.44e-3 SMART
GAF 276 432 6.56e-29 SMART
HDc 522 688 9.04e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115708
AA Change: L422P

PolyPhen 2 Score 0.745 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000111373
Gene: ENSMUSG00000023868
AA Change: L422P

DomainStartEndE-ValueType
GAF 3 148 5.22e-23 SMART
HDc 238 404 9.04e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115715
AA Change: L626P

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000111380
Gene: ENSMUSG00000023868
AA Change: L626P

DomainStartEndE-ValueType
GAF 21 174 1.44e-3 SMART
GAF 196 352 6.56e-29 SMART
HDc 442 608 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115717
Predicted Effect probably benign
Transcript: ENSMUST00000115720
AA Change: L689P

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000111385
Gene: ENSMUSG00000023868
AA Change: L689P

DomainStartEndE-ValueType
GAF 84 237 1.44e-3 SMART
GAF 259 415 6.56e-29 SMART
HDc 505 671 9.04e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115724
AA Change: L760P

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111389
Gene: ENSMUSG00000023868
AA Change: L760P

DomainStartEndE-ValueType
GAF 95 248 1.44e-3 SMART
GAF 270 426 6.56e-29 SMART
HDc 516 682 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149440
AA Change: L637P

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000123216
Gene: ENSMUSG00000023868
AA Change: L637P

DomainStartEndE-ValueType
GAF 32 185 1.44e-3 SMART
GAF 207 363 6.56e-29 SMART
HDc 453 619 9.04e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000231430
AA Change: L988P

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase family. It plays a role in signal transduction by regulating the intracellular concentration of cyclic nucleotides. This protein can hydrolyze both cAMP and cGMP to the corresponding nucleoside 5' monophosphate, but has higher affinity for cAMP, and is more efficient with cAMP as substrate. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mutation of this gene results in decreased exploratory behavior, hypoactivity, and a delay in the acquisition of conditioned avoidance behavior. A hypomorphic allele results in increased social behavior. Mice homozygous for a knock-out allele exhibit resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aph1a T A 3: 95,803,051 (GRCm39) probably null Het
Arid3a A G 10: 79,786,603 (GRCm39) E452G possibly damaging Het
Barhl2 A G 5: 106,605,506 (GRCm39) S68P unknown Het
Carf T C 1: 60,147,333 (GRCm39) S17P probably damaging Het
Ccdc90b A G 7: 92,224,019 (GRCm39) D145G probably damaging Het
Cyp7a1 A T 4: 6,271,207 (GRCm39) N316K probably benign Het
Daam2 A G 17: 49,801,419 (GRCm39) I106T possibly damaging Het
Dmtf1 A G 5: 9,176,641 (GRCm39) V437A probably benign Het
E2f2 A T 4: 135,911,751 (GRCm39) Y254F possibly damaging Het
Ehmt1 G T 2: 24,767,509 (GRCm39) P135T probably damaging Het
Ern2 T C 7: 121,779,182 (GRCm39) T221A probably benign Het
Fam227b G A 2: 125,958,043 (GRCm39) P241S probably damaging Het
Fermt1 A G 2: 132,783,883 (GRCm39) V42A possibly damaging Het
Fgf3 A G 7: 144,396,547 (GRCm39) D187G probably damaging Het
Flnb T A 14: 7,901,945 (GRCm38) V936E probably damaging Het
Herc2 T C 7: 55,772,099 (GRCm39) Y1093H probably damaging Het
Invs A G 4: 48,283,242 (GRCm39) probably benign Het
Katnb1 T A 8: 95,824,608 (GRCm39) I534N possibly damaging Het
Kcnq5 A T 1: 21,472,711 (GRCm39) D826E probably damaging Het
Klra9 A T 6: 130,165,675 (GRCm39) N113K probably benign Het
Knl1 A G 2: 118,899,657 (GRCm39) K453E probably damaging Het
Lgi4 C T 7: 30,770,182 (GRCm39) probably benign Het
Lpin3 A G 2: 160,739,058 (GRCm39) S289G probably benign Het
Mapre1 T A 2: 153,599,987 (GRCm39) V137E possibly damaging Het
Mark4 A G 7: 19,181,168 (GRCm39) F144L possibly damaging Het
Mogat2 G T 7: 98,872,842 (GRCm39) A114E possibly damaging Het
Msh2 C A 17: 88,030,841 (GRCm39) A906E probably benign Het
Nell2 A G 15: 95,425,690 (GRCm39) L19P possibly damaging Het
Nfia A T 4: 97,671,585 (GRCm39) K98N probably damaging Het
Nutm1 T A 2: 112,079,345 (GRCm39) T857S possibly damaging Het
Or14a257 TG T 7: 86,138,499 (GRCm39) probably null Het
Or52a5 T C 7: 103,426,611 (GRCm39) K314E probably benign Het
Or8g17 T A 9: 38,929,998 (GRCm39) I280F probably damaging Het
Penk A G 4: 4,134,296 (GRCm39) L117P probably damaging Het
Pgap1 A G 1: 54,521,015 (GRCm39) S876P probably damaging Het
Pmfbp1 T C 8: 110,254,399 (GRCm39) I478T possibly damaging Het
Pole G A 5: 110,442,800 (GRCm39) E318K possibly damaging Het
Prr12 C A 7: 44,695,801 (GRCm39) V1222L unknown Het
Prune2 T C 19: 17,193,721 (GRCm39) S3070P possibly damaging Het
Rnf19a A G 15: 36,244,342 (GRCm39) C573R probably benign Het
Rp1l1 T C 14: 64,267,629 (GRCm39) S1072P probably damaging Het
Rskr T C 11: 78,183,573 (GRCm39) F194L probably benign Het
Semp2l1 A T 1: 32,584,729 (GRCm39) C394S probably damaging Het
Sh3pxd2a T C 19: 47,261,850 (GRCm39) N315S possibly damaging Het
Snph T C 2: 151,436,464 (GRCm39) I86V probably damaging Het
Sox6 A G 7: 115,376,463 (GRCm39) Y90H probably damaging Het
Tbc1d13 T A 2: 30,032,323 (GRCm39) C145S probably benign Het
Tcp11l1 T C 2: 104,530,289 (GRCm39) E65G probably damaging Het
Thrb G T 14: 18,011,181 (GRCm38) E186* probably null Het
Tmem101 A G 11: 102,047,059 (GRCm39) Y38H possibly damaging Het
Trarg1 T A 11: 76,571,134 (GRCm39) L50Q probably damaging Het
Urb1 A T 16: 90,580,162 (GRCm39) probably null Het
Usp10 G A 8: 120,683,420 (GRCm39) V764I possibly damaging Het
Usp25 A G 16: 76,906,115 (GRCm39) E857G probably benign Het
Vmn1r17 A G 6: 57,337,828 (GRCm39) V130A probably benign Het
Wdr35 T C 12: 9,068,142 (GRCm39) L775P probably damaging Het
Xpnpep1 T C 19: 53,001,845 (GRCm39) T134A probably benign Het
Zbtb10 T C 3: 9,329,731 (GRCm39) V363A probably damaging Het
Zfp108 G T 7: 23,960,163 (GRCm39) K251N probably benign Het
Other mutations in Pde10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Pde10a APN 17 9,163,802 (GRCm39) missense probably damaging 1.00
IGL01762:Pde10a APN 17 9,161,750 (GRCm39) missense possibly damaging 0.74
IGL01814:Pde10a APN 17 9,147,939 (GRCm39) start codon destroyed probably null 0.00
IGL02053:Pde10a APN 17 9,193,601 (GRCm39) missense probably damaging 1.00
IGL02386:Pde10a APN 17 9,172,636 (GRCm39) missense possibly damaging 0.93
IGL02573:Pde10a APN 17 9,180,722 (GRCm39) missense probably benign 0.38
IGL02583:Pde10a APN 17 9,200,462 (GRCm39) missense probably benign 0.23
IGL02649:Pde10a APN 17 9,172,604 (GRCm39) missense probably damaging 1.00
IGL02992:Pde10a APN 17 9,168,293 (GRCm39) missense probably damaging 0.97
IGL03109:Pde10a APN 17 9,148,046 (GRCm39) critical splice donor site probably null
brautigam UTSW 17 9,183,509 (GRCm39) missense possibly damaging 0.78
Bride UTSW 17 9,168,262 (GRCm39) missense possibly damaging 0.60
buzzed UTSW 17 9,149,369 (GRCm39) missense probably damaging 1.00
Gracile UTSW 17 9,180,752 (GRCm39) missense possibly damaging 0.63
Nubile UTSW 17 9,186,294 (GRCm39) missense probably damaging 1.00
thunderball UTSW 17 9,188,421 (GRCm39) missense probably damaging 1.00
R0004:Pde10a UTSW 17 9,200,408 (GRCm39) missense probably benign 0.00
R0015:Pde10a UTSW 17 9,196,029 (GRCm39) missense probably damaging 1.00
R0015:Pde10a UTSW 17 9,196,029 (GRCm39) missense probably damaging 1.00
R0650:Pde10a UTSW 17 9,161,797 (GRCm39) missense probably damaging 1.00
R1173:Pde10a UTSW 17 9,139,378 (GRCm39) splice site probably benign
R1386:Pde10a UTSW 17 9,172,574 (GRCm39) missense probably damaging 1.00
R1458:Pde10a UTSW 17 9,183,540 (GRCm39) missense probably damaging 0.98
R1598:Pde10a UTSW 17 9,147,976 (GRCm39) missense probably damaging 1.00
R1661:Pde10a UTSW 17 9,117,702 (GRCm39) missense probably damaging 1.00
R1665:Pde10a UTSW 17 9,117,702 (GRCm39) missense probably damaging 1.00
R1883:Pde10a UTSW 17 9,197,776 (GRCm39) missense possibly damaging 0.86
R1960:Pde10a UTSW 17 9,161,750 (GRCm39) missense possibly damaging 0.74
R2005:Pde10a UTSW 17 9,147,923 (GRCm39) critical splice acceptor site probably null
R2071:Pde10a UTSW 17 9,180,827 (GRCm39) missense probably benign 0.22
R2121:Pde10a UTSW 17 9,196,047 (GRCm39) missense probably damaging 1.00
R2376:Pde10a UTSW 17 9,149,369 (GRCm39) missense probably damaging 1.00
R3721:Pde10a UTSW 17 9,188,421 (GRCm39) missense probably damaging 1.00
R3872:Pde10a UTSW 17 8,975,923 (GRCm39) missense possibly damaging 0.92
R4627:Pde10a UTSW 17 9,200,484 (GRCm39) missense probably damaging 1.00
R4652:Pde10a UTSW 17 8,975,885 (GRCm39) missense possibly damaging 0.82
R5107:Pde10a UTSW 17 9,163,802 (GRCm39) missense probably damaging 1.00
R5354:Pde10a UTSW 17 9,180,812 (GRCm39) missense probably damaging 0.97
R5735:Pde10a UTSW 17 9,160,024 (GRCm39) missense probably damaging 0.99
R5878:Pde10a UTSW 17 9,168,204 (GRCm39) missense possibly damaging 0.85
R5921:Pde10a UTSW 17 9,149,369 (GRCm39) missense probably damaging 1.00
R6027:Pde10a UTSW 17 9,183,509 (GRCm39) missense possibly damaging 0.78
R6145:Pde10a UTSW 17 9,147,949 (GRCm39) missense probably damaging 1.00
R6279:Pde10a UTSW 17 9,197,789 (GRCm39) missense probably damaging 0.99
R6409:Pde10a UTSW 17 9,168,270 (GRCm39) missense probably damaging 1.00
R6870:Pde10a UTSW 17 9,186,356 (GRCm39) missense possibly damaging 0.56
R6947:Pde10a UTSW 17 9,188,424 (GRCm39) missense probably damaging 1.00
R7072:Pde10a UTSW 17 9,161,858 (GRCm39) missense probably benign 0.40
R7084:Pde10a UTSW 17 9,159,994 (GRCm39) missense probably benign 0.25
R7294:Pde10a UTSW 17 8,975,853 (GRCm39) missense probably benign
R7339:Pde10a UTSW 17 8,975,860 (GRCm39) missense probably benign 0.01
R7347:Pde10a UTSW 17 9,186,294 (GRCm39) missense probably damaging 1.00
R7373:Pde10a UTSW 17 9,161,824 (GRCm39) missense probably benign 0.00
R7481:Pde10a UTSW 17 9,168,262 (GRCm39) missense possibly damaging 0.60
R7833:Pde10a UTSW 17 9,180,752 (GRCm39) missense possibly damaging 0.63
R7923:Pde10a UTSW 17 9,147,964 (GRCm39) missense probably benign 0.40
R8053:Pde10a UTSW 17 9,193,604 (GRCm39) missense probably benign 0.12
R8137:Pde10a UTSW 17 9,193,647 (GRCm39) missense possibly damaging 0.90
R8722:Pde10a UTSW 17 9,163,772 (GRCm39) missense probably benign 0.01
R8918:Pde10a UTSW 17 9,160,063 (GRCm39) missense possibly damaging 0.65
R8973:Pde10a UTSW 17 9,143,071 (GRCm39) missense probably benign
R9113:Pde10a UTSW 17 9,197,782 (GRCm39) missense probably benign
R9163:Pde10a UTSW 17 9,181,791 (GRCm39) missense possibly damaging 0.89
R9275:Pde10a UTSW 17 9,200,488 (GRCm39) makesense probably null
R9563:Pde10a UTSW 17 9,020,710 (GRCm39) missense unknown
R9641:Pde10a UTSW 17 9,197,816 (GRCm39) missense
R9660:Pde10a UTSW 17 9,170,370 (GRCm39) missense probably damaging 0.99
R9670:Pde10a UTSW 17 9,020,272 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TCAGAACACAGTGCCAGACG -3'
(R):5'- GGCTACAACACAGAGTAGGCTG -3'

Sequencing Primer
(F):5'- AGTGCCAGACGGTGATGC -3'
(R):5'- CAGAGTAGGCTGGACACTTGC -3'
Posted On 2016-07-06