Mutagenetix > Incidental Mutations

Incidental Mutation 'R5184:Pde10a'

397777

Institutional Source

Beutler Lab

Gene Symbol

Pde10a

Ensembl Gene

ENSMUSG00000023868

Gene Name

phosphodiesterase 10A

Synonyms

MMRRC Submission

042763-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5184 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

8525372-8986648 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 8977155 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 706 (L706P)

Ref Sequence

ENSEMBL: ENSMUSP00000086485 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024647] [ENSMUST00000089085] [ENSMUST00000115708] [ENSMUST00000115715] [ENSMUST00000115717] [ENSMUST00000115720] [ENSMUST00000115724] [ENSMUST00000149440] [ENSMUST00000231430]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000024647
AA Change: L626P

PolyPhen 2 Score 0.745 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000024647
Gene: ENSMUSG00000023868
AA Change: L626P

Domain	Start	End	E-Value	Type
GAF	21	174	1.44e-3	SMART
GAF	196	352	6.56e-29	SMART
HDc	442	608	9.04e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000089085
AA Change: L706P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000086485
Gene: ENSMUSG00000023868
AA Change: L706P

Domain	Start	End	E-Value	Type
GAF	101	254	1.44e-3	SMART
GAF	276	432	6.56e-29	SMART
HDc	522	688	9.04e-7	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115708
AA Change: L422P

PolyPhen 2 Score 0.745 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000111373
Gene: ENSMUSG00000023868
AA Change: L422P

Domain	Start	End	E-Value	Type
GAF	3	148	5.22e-23	SMART
HDc	238	404	9.04e-7	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115715
AA Change: L626P

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000111380
Gene: ENSMUSG00000023868
AA Change: L626P

Domain	Start	End	E-Value	Type
GAF	21	174	1.44e-3	SMART
GAF	196	352	6.56e-29	SMART
HDc	442	608	9.04e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000115717

Predicted Effect

probably benign
Transcript: ENSMUST00000115720
AA Change: L689P

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000111385
Gene: ENSMUSG00000023868
AA Change: L689P

Domain	Start	End	E-Value	Type
GAF	84	237	1.44e-3	SMART
GAF	259	415	6.56e-29	SMART
HDc	505	671	9.04e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115724
AA Change: L760P

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000111389
Gene: ENSMUSG00000023868
AA Change: L760P

Domain	Start	End	E-Value	Type
GAF	95	248	1.44e-3	SMART
GAF	270	426	6.56e-29	SMART
HDc	516	682	9.04e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000149440
AA Change: L637P

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000123216
Gene: ENSMUSG00000023868
AA Change: L637P

Domain	Start	End	E-Value	Type
GAF	32	185	1.44e-3	SMART
GAF	207	363	6.56e-29	SMART
HDc	453	619	9.04e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000231430
AA Change: L988P

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.6%

Validation Efficiency

98% (63/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase family. It plays a role in signal transduction by regulating the intracellular concentration of cyclic nucleotides. This protein can hydrolyze both cAMP and cGMP to the corresponding nucleoside 5' monophosphate, but has higher affinity for cAMP, and is more efficient with cAMP as substrate. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mutation of this gene results in decreased exploratory behavior, hypoactivity, and a delay in the acquisition of conditioned avoidance behavior. A hypomorphic allele results in increased social behavior. Mice homozygous for a knock-out allele exhibit resistance to diet-induced obesity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aph1a	T	A	3: 95,895,739		probably null	Het
Arid3a	A	G	10: 79,950,769	E452G	possibly damaging	Het
Barhl2	A	G	5: 106,457,640	S68P	unknown	Het
BC030499	T	C	11: 78,292,747	F194L	probably benign	Het
Carf	T	C	1: 60,108,174	S17P	probably damaging	Het
Ccdc90b	A	G	7: 92,574,811	D145G	probably damaging	Het
Cyp7a1	A	T	4: 6,271,207	N316K	probably benign	Het
Daam2	A	G	17: 49,494,391	I106T	possibly damaging	Het
Dmtf1	A	G	5: 9,126,641	V437A	probably benign	Het
E2f2	A	T	4: 136,184,440	Y254F	possibly damaging	Het
Ehmt1	G	T	2: 24,877,497	P135T	probably damaging	Het
Ern2	T	C	7: 122,179,959	T221A	probably benign	Het
Fam227b	G	A	2: 126,116,123	P241S	probably damaging	Het
Fermt1	A	G	2: 132,941,963	V42A	possibly damaging	Het
Fgf3	A	G	7: 144,842,810	D187G	probably damaging	Het
Flnb	T	A	14: 7,901,945	V936E	probably damaging	Het
Gm5415	A	T	1: 32,545,648	C394S	probably damaging	Het
Herc2	T	C	7: 56,122,351	Y1093H	probably damaging	Het
Invs	A	G	4: 48,283,242		probably benign	Het
Katnb1	T	A	8: 95,097,980	I534N	possibly damaging	Het
Kcnq5	A	T	1: 21,402,487	D826E	probably damaging	Het
Klra9	A	T	6: 130,188,712	N113K	probably benign	Het
Knl1	A	G	2: 119,069,176	K453E	probably damaging	Het
Lgi4	C	T	7: 31,070,757		probably benign	Het
Lpin3	A	G	2: 160,897,138	S289G	probably benign	Het
Mapre1	T	A	2: 153,758,067	V137E	possibly damaging	Het
Mark4	A	G	7: 19,447,243	F144L	possibly damaging	Het
Mogat2	G	T	7: 99,223,635	A114E	possibly damaging	Het
Msh2	C	A	17: 87,723,413	A906E	probably benign	Het
Nell2	A	G	15: 95,527,809	L19P	possibly damaging	Het
Nfia	A	T	4: 97,783,348	K98N	probably damaging	Het
Nutm1	T	A	2: 112,249,000	T857S	possibly damaging	Het
Olfr146	T	A	9: 39,018,702	I280F	probably damaging	Het
Olfr298	TG	T	7: 86,489,291		probably null	Het
Olfr68	T	C	7: 103,777,404	K314E	probably benign	Het
Penk	A	G	4: 4,134,296	L117P	probably damaging	Het
Pgap1	A	G	1: 54,481,856	S876P	probably damaging	Het
Pmfbp1	T	C	8: 109,527,767	I478T	possibly damaging	Het
Pole	G	A	5: 110,294,934	E318K	possibly damaging	Het
Prr12	C	A	7: 45,046,377	V1222L	unknown	Het
Prune2	T	C	19: 17,216,357	S3070P	possibly damaging	Het
Rnf19a	A	G	15: 36,244,196	C573R	probably benign	Het
Rp1l1	T	C	14: 64,030,180	S1072P	probably damaging	Het
Sh3pxd2a	T	C	19: 47,273,411	N315S	possibly damaging	Het
Snph	T	C	2: 151,594,544	I86V	probably damaging	Het
Sox6	A	G	7: 115,777,228	Y90H	probably damaging	Het
Tbc1d13	T	A	2: 30,142,311	C145S	probably benign	Het
Tcp11l1	T	C	2: 104,699,944	E65G	probably damaging	Het
Thrb	G	T	14: 18,011,181	E186*	probably null	Het
Tmem101	A	G	11: 102,156,233	Y38H	possibly damaging	Het
Tusc5	T	A	11: 76,680,308	L50Q	probably damaging	Het
Urb1	A	T	16: 90,783,274		probably null	Het
Usp10	G	A	8: 119,956,681	V764I	possibly damaging	Het
Usp25	A	G	16: 77,109,227	E857G	probably benign	Het
Vmn1r17	A	G	6: 57,360,843	V130A	probably benign	Het
Wdr35	T	C	12: 9,018,142	L775P	probably damaging	Het
Xpnpep1	T	C	19: 53,013,414	T134A	probably benign	Het
Zbtb10	T	C	3: 9,264,671	V363A	probably damaging	Het
Zfp108	G	T	7: 24,260,738	K251N	probably benign	Het

Other mutations in Pde10a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01534:Pde10a	APN	17	8944970	missense	probably damaging	1.00
IGL01762:Pde10a	APN	17	8942918	missense	possibly damaging	0.74
IGL01814:Pde10a	APN	17	8929107	start codon destroyed	probably null	0.00
IGL02053:Pde10a	APN	17	8974769	missense	probably damaging	1.00
IGL02386:Pde10a	APN	17	8953804	missense	possibly damaging	0.93
IGL02573:Pde10a	APN	17	8961890	missense	probably benign	0.38
IGL02583:Pde10a	APN	17	8981630	missense	probably benign	0.23
IGL02649:Pde10a	APN	17	8953772	missense	probably damaging	1.00
IGL02992:Pde10a	APN	17	8949461	missense	probably damaging	0.97
IGL03109:Pde10a	APN	17	8929214	critical splice donor site	probably null
brautigam	UTSW	17	8964677	missense	possibly damaging	0.78
Bride	UTSW	17	8949430	missense	possibly damaging	0.60
buzzed	UTSW	17	8930537	missense	probably damaging	1.00
Gracile	UTSW	17	8961920	missense	possibly damaging	0.63
Nubile	UTSW	17	8967462	missense	probably damaging	1.00
thunderball	UTSW	17	8969589	missense	probably damaging	1.00
R0004:Pde10a	UTSW	17	8981576	missense	probably benign	0.00
R0015:Pde10a	UTSW	17	8977197	missense	probably damaging	1.00
R0015:Pde10a	UTSW	17	8977197	missense	probably damaging	1.00
R0650:Pde10a	UTSW	17	8942965	missense	probably damaging	1.00
R1173:Pde10a	UTSW	17	8920546	splice site	probably benign
R1386:Pde10a	UTSW	17	8953742	missense	probably damaging	1.00
R1458:Pde10a	UTSW	17	8964708	missense	probably damaging	0.98
R1598:Pde10a	UTSW	17	8929144	missense	probably damaging	1.00
R1661:Pde10a	UTSW	17	8898870	missense	probably damaging	1.00
R1665:Pde10a	UTSW	17	8898870	missense	probably damaging	1.00
R1883:Pde10a	UTSW	17	8978944	missense	possibly damaging	0.86
R1960:Pde10a	UTSW	17	8942918	missense	possibly damaging	0.74
R2005:Pde10a	UTSW	17	8929091	critical splice acceptor site	probably null
R2071:Pde10a	UTSW	17	8961995	missense	probably benign	0.22
R2121:Pde10a	UTSW	17	8977215	missense	probably damaging	1.00
R2376:Pde10a	UTSW	17	8930537	missense	probably damaging	1.00
R3721:Pde10a	UTSW	17	8969589	missense	probably damaging	1.00
R3872:Pde10a	UTSW	17	8757091	missense	possibly damaging	0.92
R4627:Pde10a	UTSW	17	8981652	missense	probably damaging	1.00
R4652:Pde10a	UTSW	17	8757053	missense	possibly damaging	0.82
R5107:Pde10a	UTSW	17	8944970	missense	probably damaging	1.00
R5354:Pde10a	UTSW	17	8961980	missense	probably damaging	0.97
R5735:Pde10a	UTSW	17	8941192	missense	probably damaging	0.99
R5878:Pde10a	UTSW	17	8949372	missense	possibly damaging	0.85
R5921:Pde10a	UTSW	17	8930537	missense	probably damaging	1.00
R6027:Pde10a	UTSW	17	8964677	missense	possibly damaging	0.78
R6145:Pde10a	UTSW	17	8929117	missense	probably damaging	1.00
R6279:Pde10a	UTSW	17	8978957	missense	probably damaging	0.99
R6409:Pde10a	UTSW	17	8949438	missense	probably damaging	1.00
R6870:Pde10a	UTSW	17	8967524	missense	possibly damaging	0.56
R6947:Pde10a	UTSW	17	8969592	missense	probably damaging	1.00
R7072:Pde10a	UTSW	17	8943026	missense	probably benign	0.40
R7084:Pde10a	UTSW	17	8941162	missense	probably benign	0.25
R7294:Pde10a	UTSW	17	8757021	missense	probably benign
R7339:Pde10a	UTSW	17	8757028	missense	probably benign	0.01
R7347:Pde10a	UTSW	17	8967462	missense	probably damaging	1.00
R7373:Pde10a	UTSW	17	8942992	missense	probably benign	0.00
R7481:Pde10a	UTSW	17	8949430	missense	possibly damaging	0.60
R7833:Pde10a	UTSW	17	8961920	missense	possibly damaging	0.63
R7923:Pde10a	UTSW	17	8929132	missense	probably benign	0.40
R8053:Pde10a	UTSW	17	8974772	missense	probably benign	0.12
R8137:Pde10a	UTSW	17	8974815	missense	possibly damaging	0.90
R8722:Pde10a	UTSW	17	8944940	missense	probably benign	0.01
R8918:Pde10a	UTSW	17	8941231	missense	possibly damaging	0.65
R8973:Pde10a	UTSW	17	8924239	missense	probably benign
R9113:Pde10a	UTSW	17	8978950	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCAGAACACAGTGCCAGACG -3'
(R):5'- GGCTACAACACAGAGTAGGCTG -3'

Sequencing Primer
(F):5'- AGTGCCAGACGGTGATGC -3'
(R):5'- CAGAGTAGGCTGGACACTTGC -3'

Posted On

2016-07-06