Mutagenetix > Incidental Mutation

Incidental Mutation 'R5184:Sh3pxd2a'

397781

Institutional Source

Beutler Lab

Gene Symbol

Sh3pxd2a

Ensembl Gene

ENSMUSG00000053617

Gene Name

SH3 and PX domains 2A

Synonyms

Tks5, Fish, Sh3md1, 2310014D11Rik

MMRRC Submission

042763-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5184 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

47260174-47464411 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 47273411 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 315 (N315S)

Ref Sequence

ENSEMBL: ENSMUSP00000107430 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081619] [ENSMUST00000111800]

AlphaFold

O89032

Predicted Effect

possibly damaging
Transcript: ENSMUST00000081619
AA Change: N343S

PolyPhen 2 Score 0.640 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000080325
Gene: ENSMUSG00000053617
AA Change: N343S

Domain	Start	End	E-Value	Type
PX	3	124	3.6e-32	SMART
SH3	169	224	3.24e-16	SMART
low complexity region	242	254	N/A	INTRINSIC
SH3	269	324	6.49e-16	SMART
low complexity region	360	371	N/A	INTRINSIC
SH3	450	505	4.49e-10	SMART
low complexity region	519	537	N/A	INTRINSIC
low complexity region	632	652	N/A	INTRINSIC
low complexity region	654	676	N/A	INTRINSIC
low complexity region	685	709	N/A	INTRINSIC
SH3	836	891	2.41e-10	SMART
SH3	1066	1124	3.85e-9	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111800
AA Change: N315S

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000107430
Gene: ENSMUSG00000053617
AA Change: N315S

Domain	Start	End	E-Value	Type
PX	3	124	3.6e-32	SMART
SH3	169	224	3.24e-16	SMART
SH3	241	296	6.49e-16	SMART
low complexity region	332	343	N/A	INTRINSIC
SH3	422	477	4.49e-10	SMART
low complexity region	491	509	N/A	INTRINSIC
low complexity region	604	624	N/A	INTRINSIC
low complexity region	626	648	N/A	INTRINSIC
low complexity region	657	681	N/A	INTRINSIC
SH3	808	863	2.41e-10	SMART
SH3	1038	1096	3.85e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183658

Meta Mutation Damage Score

0.0712

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.6%

Validation Efficiency

98% (63/64)

MGI Phenotype

PHENOTYPE: Homozygous disruption of this gene results in high neonatal lethality associated with a complete cleft of the secondary palate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aph1a	T	A	3: 95,895,739		probably null	Het
Arid3a	A	G	10: 79,950,769	E452G	possibly damaging	Het
Barhl2	A	G	5: 106,457,640	S68P	unknown	Het
BC030499	T	C	11: 78,292,747	F194L	probably benign	Het
Carf	T	C	1: 60,108,174	S17P	probably damaging	Het
Ccdc90b	A	G	7: 92,574,811	D145G	probably damaging	Het
Cyp7a1	A	T	4: 6,271,207	N316K	probably benign	Het
Daam2	A	G	17: 49,494,391	I106T	possibly damaging	Het
Dmtf1	A	G	5: 9,126,641	V437A	probably benign	Het
E2f2	A	T	4: 136,184,440	Y254F	possibly damaging	Het
Ehmt1	G	T	2: 24,877,497	P135T	probably damaging	Het
Ern2	T	C	7: 122,179,959	T221A	probably benign	Het
Fam227b	G	A	2: 126,116,123	P241S	probably damaging	Het
Fermt1	A	G	2: 132,941,963	V42A	possibly damaging	Het
Fgf3	A	G	7: 144,842,810	D187G	probably damaging	Het
Flnb	T	A	14: 7,901,945	V936E	probably damaging	Het
Gm5415	A	T	1: 32,545,648	C394S	probably damaging	Het
Herc2	T	C	7: 56,122,351	Y1093H	probably damaging	Het
Invs	A	G	4: 48,283,242		probably benign	Het
Katnb1	T	A	8: 95,097,980	I534N	possibly damaging	Het
Kcnq5	A	T	1: 21,402,487	D826E	probably damaging	Het
Klra9	A	T	6: 130,188,712	N113K	probably benign	Het
Knl1	A	G	2: 119,069,176	K453E	probably damaging	Het
Lgi4	C	T	7: 31,070,757		probably benign	Het
Lpin3	A	G	2: 160,897,138	S289G	probably benign	Het
Mapre1	T	A	2: 153,758,067	V137E	possibly damaging	Het
Mark4	A	G	7: 19,447,243	F144L	possibly damaging	Het
Mogat2	G	T	7: 99,223,635	A114E	possibly damaging	Het
Msh2	C	A	17: 87,723,413	A906E	probably benign	Het
Nell2	A	G	15: 95,527,809	L19P	possibly damaging	Het
Nfia	A	T	4: 97,783,348	K98N	probably damaging	Het
Nutm1	T	A	2: 112,249,000	T857S	possibly damaging	Het
Olfr146	T	A	9: 39,018,702	I280F	probably damaging	Het
Olfr298	TG	T	7: 86,489,291		probably null	Het
Olfr68	T	C	7: 103,777,404	K314E	probably benign	Het
Pde10a	T	C	17: 8,977,155	L706P	probably damaging	Het
Penk	A	G	4: 4,134,296	L117P	probably damaging	Het
Pgap1	A	G	1: 54,481,856	S876P	probably damaging	Het
Pmfbp1	T	C	8: 109,527,767	I478T	possibly damaging	Het
Pole	G	A	5: 110,294,934	E318K	possibly damaging	Het
Prr12	C	A	7: 45,046,377	V1222L	unknown	Het
Prune2	T	C	19: 17,216,357	S3070P	possibly damaging	Het
Rnf19a	A	G	15: 36,244,196	C573R	probably benign	Het
Rp1l1	T	C	14: 64,030,180	S1072P	probably damaging	Het
Snph	T	C	2: 151,594,544	I86V	probably damaging	Het
Sox6	A	G	7: 115,777,228	Y90H	probably damaging	Het
Tbc1d13	T	A	2: 30,142,311	C145S	probably benign	Het
Tcp11l1	T	C	2: 104,699,944	E65G	probably damaging	Het
Thrb	G	T	14: 18,011,181	E186*	probably null	Het
Tmem101	A	G	11: 102,156,233	Y38H	possibly damaging	Het
Tusc5	T	A	11: 76,680,308	L50Q	probably damaging	Het
Urb1	A	T	16: 90,783,274		probably null	Het
Usp10	G	A	8: 119,956,681	V764I	possibly damaging	Het
Usp25	A	G	16: 77,109,227	E857G	probably benign	Het
Vmn1r17	A	G	6: 57,360,843	V130A	probably benign	Het
Wdr35	T	C	12: 9,018,142	L775P	probably damaging	Het
Xpnpep1	T	C	19: 53,013,414	T134A	probably benign	Het
Zbtb10	T	C	3: 9,264,671	V363A	probably damaging	Het
Zfp108	G	T	7: 24,260,738	K251N	probably benign	Het

Other mutations in Sh3pxd2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00900:Sh3pxd2a	APN	19	47314155	missense	probably benign	0.20
IGL01606:Sh3pxd2a	APN	19	47268596	missense	probably benign
IGL02001:Sh3pxd2a	APN	19	47273447	missense	probably damaging	0.99
IGL02060:Sh3pxd2a	APN	19	47373378	splice site	probably benign
IGL02830:Sh3pxd2a	APN	19	47283078	missense	probably damaging	1.00
IGL03240:Sh3pxd2a	APN	19	47268026	missense	probably damaging	1.00
IGL03263:Sh3pxd2a	APN	19	47314043	missense	probably damaging	1.00
IGL03290:Sh3pxd2a	APN	19	47424516	missense	probably damaging	1.00
R0045:Sh3pxd2a	UTSW	19	47267183	missense	probably damaging	1.00
R0045:Sh3pxd2a	UTSW	19	47267183	missense	probably damaging	1.00
R0504:Sh3pxd2a	UTSW	19	47267747	missense	probably damaging	1.00
R0683:Sh3pxd2a	UTSW	19	47267511	missense	probably benign	0.04
R0726:Sh3pxd2a	UTSW	19	47268762	missense	probably damaging	1.00
R0883:Sh3pxd2a	UTSW	19	47268207	missense	probably damaging	1.00
R1276:Sh3pxd2a	UTSW	19	47268383	missense	probably benign
R1349:Sh3pxd2a	UTSW	19	47267721	missense	probably damaging	1.00
R1372:Sh3pxd2a	UTSW	19	47267721	missense	probably damaging	1.00
R1525:Sh3pxd2a	UTSW	19	47278425	missense	probably damaging	1.00
R1661:Sh3pxd2a	UTSW	19	47278320	missense	probably damaging	1.00
R1664:Sh3pxd2a	UTSW	19	47268382	missense	probably benign	0.02
R1766:Sh3pxd2a	UTSW	19	47273250	missense	probably benign	0.01
R1931:Sh3pxd2a	UTSW	19	47267508	missense	probably benign	0.00
R1932:Sh3pxd2a	UTSW	19	47267508	missense	probably benign	0.00
R2024:Sh3pxd2a	UTSW	19	47267264	missense	probably benign	0.35
R2165:Sh3pxd2a	UTSW	19	47278355	missense	probably damaging	1.00
R2210:Sh3pxd2a	UTSW	19	47267343	missense	possibly damaging	0.93
R2567:Sh3pxd2a	UTSW	19	47424569	missense	possibly damaging	0.94
R4097:Sh3pxd2a	UTSW	19	47424512	missense	probably damaging	1.00
R4466:Sh3pxd2a	UTSW	19	47364707	missense	possibly damaging	0.61
R4788:Sh3pxd2a	UTSW	19	47314079	missense	probably damaging	1.00
R4885:Sh3pxd2a	UTSW	19	47268693	missense	probably damaging	1.00
R4939:Sh3pxd2a	UTSW	19	47278404	missense	probably damaging	1.00
R5340:Sh3pxd2a	UTSW	19	47268231	missense	probably benign	0.36
R5673:Sh3pxd2a	UTSW	19	47268666	missense	probably damaging	1.00
R5925:Sh3pxd2a	UTSW	19	47267612	missense	probably damaging	1.00
R5988:Sh3pxd2a	UTSW	19	47364638	missense	probably benign	0.16
R6120:Sh3pxd2a	UTSW	19	47267409	missense	probably damaging	0.99
R6432:Sh3pxd2a	UTSW	19	47269927	missense	probably damaging	0.99
R6650:Sh3pxd2a	UTSW	19	47268224	missense	probably benign	0.00
R6700:Sh3pxd2a	UTSW	19	47364707	missense	possibly damaging	0.61
R6831:Sh3pxd2a	UTSW	19	47283093	missense	probably damaging	1.00
R7015:Sh3pxd2a	UTSW	19	47268123	missense	probably benign	0.00
R7225:Sh3pxd2a	UTSW	19	47267389	missense	probably damaging	1.00
R7449:Sh3pxd2a	UTSW	19	47267652	missense	probably benign
R7695:Sh3pxd2a	UTSW	19	47267831	missense	probably damaging	1.00
R7904:Sh3pxd2a	UTSW	19	47320314	missense	possibly damaging	0.54
R8143:Sh3pxd2a	UTSW	19	47268699	missense	probably damaging	1.00
R8268:Sh3pxd2a	UTSW	19	47267594	missense	probably benign
R8290:Sh3pxd2a	UTSW	19	47314136	missense	probably damaging	1.00
R8350:Sh3pxd2a	UTSW	19	47268707	missense	probably damaging	1.00
R8350:Sh3pxd2a	UTSW	19	47269838	missense	probably null	0.72
R8742:Sh3pxd2a	UTSW	19	47286634	missense	probably benign	0.01
R8767:Sh3pxd2a	UTSW	19	47268906	missense	probably damaging	1.00
R8948:Sh3pxd2a	UTSW	19	47373443	missense	probably damaging	1.00
R9357:Sh3pxd2a	UTSW	19	47272009	missense	probably damaging	1.00
R9433:Sh3pxd2a	UTSW	19	47267100	missense	probably damaging	0.98
R9515:Sh3pxd2a	UTSW	19	47267171	missense	probably damaging	1.00
R9748:Sh3pxd2a	UTSW	19	47268654	missense	probably benign
V3553:Sh3pxd2a	UTSW	19	47267219	missense	probably benign	0.12
X0013:Sh3pxd2a	UTSW	19	47267864	missense	probably benign	0.01
X0026:Sh3pxd2a	UTSW	19	47464150	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- TTACTGATCTGGGCCCTCTG -3'
(R):5'- AACCTCTAGCAGAGCCTTCC -3'

Sequencing Primer
(F):5'- CCCTGGGCTAGCTTGGATG -3'
(R):5'- TTCCAGAGAAGGCTCGGCTAG -3'

Posted On

2016-07-06