Incidental Mutation 'R5184:Xpnpep1'
ID397782
Institutional Source Beutler Lab
Gene Symbol Xpnpep1
Ensembl Gene ENSMUSG00000025027
Gene NameX-prolyl aminopeptidase (aminopeptidase P) 1, soluble
SynonymsD230045I08Rik
MMRRC Submission 042763-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5184 (G1)
Quality Score203
Status Validated
Chromosome19
Chromosomal Location52943417-53040214 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53013414 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 134 (T134A)
Ref Sequence ENSEMBL: ENSMUSP00000138250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182097] [ENSMUST00000182500] [ENSMUST00000183108] [ENSMUST00000183274]
Predicted Effect probably benign
Transcript: ENSMUST00000182097
AA Change: T91A

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000138473
Gene: ENSMUSG00000025027
AA Change: T91A

DomainStartEndE-ValueType
Pfam:Creatinase_N 9 119 5.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182534
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182844
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182877
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182887
Predicted Effect probably benign
Transcript: ENSMUST00000183108
AA Change: T134A

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000138250
Gene: ENSMUSG00000025027
AA Change: T134A

DomainStartEndE-ValueType
Pfam:Creatinase_N 53 198 1.2e-17 PFAM
Pfam:Peptidase_M24 371 587 5.5e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183188
Predicted Effect probably benign
Transcript: ENSMUST00000183274
AA Change: T134A

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000138233
Gene: ENSMUSG00000025027
AA Change: T134A

DomainStartEndE-ValueType
Pfam:Creatinase_N 53 198 1.2e-17 PFAM
Pfam:Peptidase_M24 371 587 1.9e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184510
Meta Mutation Damage Score 0.1780 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the cytosolic form of a metalloaminopeptidase that catalyzes the cleavage of the N-terminal amino acid adjacent to a proline residue. The gene product may play a role in degradation and maturation of tachykinins, neuropeptides, and peptide hormones. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit pre and postnatal lethality, reduced male survival, growth retardation with decreased body weight, size and length, microcephaly and peptiduria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aph1a T A 3: 95,895,739 probably null Het
Arid3a A G 10: 79,950,769 E452G possibly damaging Het
Barhl2 A G 5: 106,457,640 S68P unknown Het
BC030499 T C 11: 78,292,747 F194L probably benign Het
Carf T C 1: 60,108,174 S17P probably damaging Het
Ccdc90b A G 7: 92,574,811 D145G probably damaging Het
Cyp7a1 A T 4: 6,271,207 N316K probably benign Het
Daam2 A G 17: 49,494,391 I106T possibly damaging Het
Dmtf1 A G 5: 9,126,641 V437A probably benign Het
E2f2 A T 4: 136,184,440 Y254F possibly damaging Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Ern2 T C 7: 122,179,959 T221A probably benign Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fermt1 A G 2: 132,941,963 V42A possibly damaging Het
Fgf3 A G 7: 144,842,810 D187G probably damaging Het
Flnb T A 14: 7,901,945 V936E probably damaging Het
Gm5415 A T 1: 32,545,648 C394S probably damaging Het
Herc2 T C 7: 56,122,351 Y1093H probably damaging Het
Invs A G 4: 48,283,242 probably benign Het
Katnb1 T A 8: 95,097,980 I534N possibly damaging Het
Kcnq5 A T 1: 21,402,487 D826E probably damaging Het
Klra9 A T 6: 130,188,712 N113K probably benign Het
Knl1 A G 2: 119,069,176 K453E probably damaging Het
Lgi4 C T 7: 31,070,757 probably benign Het
Lpin3 A G 2: 160,897,138 S289G probably benign Het
Mapre1 T A 2: 153,758,067 V137E possibly damaging Het
Mark4 A G 7: 19,447,243 F144L possibly damaging Het
Mogat2 G T 7: 99,223,635 A114E possibly damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Nell2 A G 15: 95,527,809 L19P possibly damaging Het
Nfia A T 4: 97,783,348 K98N probably damaging Het
Nutm1 T A 2: 112,249,000 T857S possibly damaging Het
Olfr146 T A 9: 39,018,702 I280F probably damaging Het
Olfr298 TG T 7: 86,489,291 probably null Het
Olfr68 T C 7: 103,777,404 K314E probably benign Het
Pde10a T C 17: 8,977,155 L706P probably damaging Het
Penk A G 4: 4,134,296 L117P probably damaging Het
Pgap1 A G 1: 54,481,856 S876P probably damaging Het
Pmfbp1 T C 8: 109,527,767 I478T possibly damaging Het
Pole G A 5: 110,294,934 E318K possibly damaging Het
Prr12 C A 7: 45,046,377 V1222L unknown Het
Prune2 T C 19: 17,216,357 S3070P possibly damaging Het
Rnf19a A G 15: 36,244,196 C573R probably benign Het
Rp1l1 T C 14: 64,030,180 S1072P probably damaging Het
Sh3pxd2a T C 19: 47,273,411 N315S possibly damaging Het
Snph T C 2: 151,594,544 I86V probably damaging Het
Sox6 A G 7: 115,777,228 Y90H probably damaging Het
Tbc1d13 T A 2: 30,142,311 C145S probably benign Het
Tcp11l1 T C 2: 104,699,944 E65G probably damaging Het
Thrb G T 14: 18,011,181 E186* probably null Het
Tmem101 A G 11: 102,156,233 Y38H possibly damaging Het
Tusc5 T A 11: 76,680,308 L50Q probably damaging Het
Urb1 A T 16: 90,783,274 probably null Het
Usp10 G A 8: 119,956,681 V764I possibly damaging Het
Usp25 A G 16: 77,109,227 E857G probably benign Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Wdr35 T C 12: 9,018,142 L775P probably damaging Het
Zbtb10 T C 3: 9,264,671 V363A probably damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Other mutations in Xpnpep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Xpnpep1 APN 19 53010148 missense probably benign 0.06
IGL01665:Xpnpep1 APN 19 52997032 missense probably benign 0.00
IGL01833:Xpnpep1 APN 19 53000393 missense probably damaging 1.00
IGL02011:Xpnpep1 APN 19 53002465 critical splice donor site probably benign 0.00
IGL03229:Xpnpep1 APN 19 53025380 missense probably benign
IGL03334:Xpnpep1 APN 19 53010146 missense probably damaging 1.00
R0226:Xpnpep1 UTSW 19 53010152 missense probably benign 0.03
R0613:Xpnpep1 UTSW 19 53006353 missense probably damaging 0.97
R0648:Xpnpep1 UTSW 19 52997863 splice site probably benign
R1543:Xpnpep1 UTSW 19 52991676 missense probably benign 0.24
R1553:Xpnpep1 UTSW 19 53006338 missense probably benign 0.00
R1801:Xpnpep1 UTSW 19 53010133 missense probably damaging 1.00
R1853:Xpnpep1 UTSW 19 53006210 missense probably benign 0.01
R2234:Xpnpep1 UTSW 19 53013461 missense probably damaging 1.00
R3797:Xpnpep1 UTSW 19 53006342 missense probably benign 0.28
R3820:Xpnpep1 UTSW 19 53003819 splice site probably benign
R3822:Xpnpep1 UTSW 19 53003819 splice site probably benign
R3925:Xpnpep1 UTSW 19 52991697 missense probably damaging 1.00
R4831:Xpnpep1 UTSW 19 53014622 missense probably benign 0.09
R5033:Xpnpep1 UTSW 19 53006175 missense probably benign
R5468:Xpnpep1 UTSW 19 52995519 missense probably benign 0.01
R5573:Xpnpep1 UTSW 19 53004822 missense probably damaging 1.00
R5876:Xpnpep1 UTSW 19 52997008 missense probably damaging 1.00
R5929:Xpnpep1 UTSW 19 53013489 missense probably damaging 1.00
R6454:Xpnpep1 UTSW 19 52997879 missense possibly damaging 0.91
R6519:Xpnpep1 UTSW 19 53011844 missense possibly damaging 0.90
R7095:Xpnpep1 UTSW 19 53011765 critical splice donor site probably null
R7112:Xpnpep1 UTSW 19 53010107 missense probably benign
R7412:Xpnpep1 UTSW 19 53006291 missense probably benign
RF017:Xpnpep1 UTSW 19 53032060 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- TGGTGTGTACAAAACAGCATAGTG -3'
(R):5'- CAGGCGTTTCCTTGGAGTCTAG -3'

Sequencing Primer
(F):5'- AAGCATTCTACCAGCCCT -3'
(R):5'- AGTCTAGGACTCCTGTGCG -3'
Posted On2016-07-06