Incidental Mutation 'R5185:Ccdc171'
ID397802
Institutional Source Beutler Lab
Gene Symbol Ccdc171
Ensembl Gene ENSMUSG00000052407
Gene Namecoiled-coil domain containing 171
Synonyms4930473A06Rik, 4930418J05Rik, A330015D16Rik
MMRRC Submission 042764-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock #R5185 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location83525545-83864670 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 83663655 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 674 (S674A)
Ref Sequence ENSEMBL: ENSMUSP00000056520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053414] [ENSMUST00000125077] [ENSMUST00000231339]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053414
AA Change: S674A

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000056520
Gene: ENSMUSG00000052407
AA Change: S674A

DomainStartEndE-ValueType
coiled coil region 48 298 N/A INTRINSIC
coiled coil region 325 393 N/A INTRINSIC
coiled coil region 453 527 N/A INTRINSIC
coiled coil region 599 628 N/A INTRINSIC
coiled coil region 653 712 N/A INTRINSIC
low complexity region 728 743 N/A INTRINSIC
low complexity region 783 797 N/A INTRINSIC
coiled coil region 981 1145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125077
SMART Domains Protein: ENSMUSP00000116486
Gene: ENSMUSG00000052407

DomainStartEndE-ValueType
coiled coil region 48 298 N/A INTRINSIC
coiled coil region 325 393 N/A INTRINSIC
coiled coil region 453 535 N/A INTRINSIC
coiled coil region 607 636 N/A INTRINSIC
coiled coil region 661 720 N/A INTRINSIC
low complexity region 736 751 N/A INTRINSIC
low complexity region 791 805 N/A INTRINSIC
coiled coil region 989 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231339
AA Change: S682A

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.0704 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 95% (70/74)
MGI Phenotype PHENOTYPE: Mice that either homozygous or heterozygous for an ENU-induced single point mutation exhibit decreased mature B cell number, decreased IgD level, and increased IgM level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf2 T C 11: 94,562,911 Y408C probably damaging Het
Aox4 T C 1: 58,254,318 L943S probably damaging Het
Ap1g1 G A 8: 109,863,326 probably benign Het
Arsb T C 13: 93,794,159 S212P probably damaging Het
Arsi A G 18: 60,916,912 N289S probably damaging Het
Atp6v1h T A 1: 5,095,642 F72I probably damaging Het
Atxn7 T C 14: 14,090,063 I336T probably benign Het
Bak1 G A 17: 27,022,748 P65L possibly damaging Het
Bcl6 A T 16: 23,972,947 M219K possibly damaging Het
Brd3 T C 2: 27,462,448 K157E probably damaging Het
Cfap43 A G 19: 47,780,394 I737T probably benign Het
Cul9 A T 17: 46,525,832 V1089D possibly damaging Het
Dffa C A 4: 149,117,430 A155E probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Efcab12 T A 6: 115,823,490 M191L probably benign Het
Efl1 T C 7: 82,772,499 L1018P probably damaging Het
Fcho1 A G 8: 71,714,956 probably benign Het
Fndc3b T A 3: 27,457,070 T764S probably benign Het
Gm29125 T C 1: 80,384,231 noncoding transcript Het
Gm5108 A G 5: 67,944,610 probably benign Het
Gm9949 T G 18: 62,180,565 probably benign Het
Golgb1 T C 16: 36,875,141 probably benign Het
Gpd2 T C 2: 57,340,204 Y323H probably damaging Het
Grip1 T G 10: 119,931,259 D96E probably benign Het
Hmcn1 T C 1: 150,656,741 I3132V probably benign Het
Hsd17b1 T C 11: 101,080,198 W327R possibly damaging Het
Htra2 G A 6: 83,054,242 P62L probably benign Het
Kdr A T 5: 75,952,417 probably null Het
Kif14 T A 1: 136,527,469 C1626* probably null Het
Kmt2a A T 9: 44,820,246 probably benign Het
Krt15 T C 11: 100,133,433 T321A probably damaging Het
Lactbl1 A T 4: 136,631,045 H109L probably benign Het
Lilra6 T A 7: 3,914,636 H120L probably benign Het
Lpcat2 G A 8: 92,869,737 S134N probably benign Het
Mpp4 T C 1: 59,125,583 D465G probably benign Het
Naip2 A T 13: 100,189,351 D16E probably damaging Het
Nek5 C T 8: 22,083,381 A520T possibly damaging Het
Nfatc2 A G 2: 168,570,707 F132L possibly damaging Het
Nlrp3 C A 11: 59,565,084 T902N probably benign Het
Olfr1097 T C 2: 86,890,602 D191G probably benign Het
Olfr1230 A T 2: 89,296,387 H294Q probably benign Het
Olfr149 A T 9: 39,701,876 W298R probably benign Het
Olfr58 T C 9: 19,783,376 M81T probably damaging Het
Pcdhb16 T C 18: 37,480,089 S701P possibly damaging Het
Phf7 A G 14: 31,248,037 probably null Het
Plpp4 G A 7: 129,316,304 V68M probably damaging Het
Pnma2 A T 14: 66,916,129 M1L possibly damaging Het
Pnmal2 A T 7: 16,945,976 D295V probably damaging Het
Rad21l T C 2: 151,657,462 D270G probably benign Het
Ralgapa2 C A 2: 146,388,486 probably null Het
Rasal3 A T 17: 32,396,790 L334Q probably damaging Het
Rfx4 G T 10: 84,863,250 R240L probably damaging Het
Rnf19b T A 4: 129,083,920 C642* probably null Het
Slc28a2 G A 2: 122,458,194 E594K probably benign Het
Spata31 G T 13: 64,917,526 W15L possibly damaging Het
Spink5 T C 18: 44,015,644 S925P probably damaging Het
Svep1 C T 4: 58,084,534 G1865S probably damaging Het
Tg T C 15: 66,773,474 L791P probably damaging Het
Thbs4 A C 13: 92,775,167 V247G probably damaging Het
Tpcn2 A T 7: 145,255,454 F705Y probably damaging Het
Try10 A T 6: 41,356,549 H76L probably damaging Het
Ttn C T 2: 76,939,221 V2695I probably damaging Het
Tut1 C A 19: 8,955,450 T49N probably benign Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Xdh G A 17: 73,925,011 R235C probably damaging Het
Yipf4 A G 17: 74,492,475 D70G probably null Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Other mutations in Ccdc171
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Ccdc171 APN 4 83682324 nonsense probably null
IGL00707:Ccdc171 APN 4 83681155 missense probably benign 0.11
IGL00907:Ccdc171 APN 4 83864249 missense probably damaging 0.98
IGL01113:Ccdc171 APN 4 83661810 missense probably damaging 1.00
IGL01669:Ccdc171 APN 4 83681195 missense probably damaging 1.00
IGL01696:Ccdc171 APN 4 83655578 missense possibly damaging 0.66
IGL02006:Ccdc171 APN 4 83795242 missense possibly damaging 0.93
IGL02582:Ccdc171 APN 4 83743018 missense probably damaging 1.00
IGL03019:Ccdc171 APN 4 83795308 missense probably damaging 1.00
IGL03144:Ccdc171 APN 4 83818090 missense probably damaging 0.99
IGL03350:Ccdc171 APN 4 83681378 missense possibly damaging 0.67
IGL03377:Ccdc171 APN 4 83663517 missense probably damaging 1.00
PIT4131001:Ccdc171 UTSW 4 83661709
PIT4445001:Ccdc171 UTSW 4 83661747 missense probably damaging 1.00
R0219:Ccdc171 UTSW 4 83696441 splice site probably benign
R0284:Ccdc171 UTSW 4 83549738 missense possibly damaging 0.62
R0355:Ccdc171 UTSW 4 83635682 missense probably damaging 1.00
R1248:Ccdc171 UTSW 4 83681244 missense possibly damaging 0.46
R1278:Ccdc171 UTSW 4 83661858 missense possibly damaging 0.90
R1495:Ccdc171 UTSW 4 83681095 nonsense probably null
R1741:Ccdc171 UTSW 4 83620839 missense probably damaging 0.97
R1742:Ccdc171 UTSW 4 83681284 missense probably damaging 0.99
R1789:Ccdc171 UTSW 4 83554808 missense probably damaging 0.99
R1801:Ccdc171 UTSW 4 83546895 missense probably benign 0.41
R4204:Ccdc171 UTSW 4 83681155 missense probably benign 0.11
R4245:Ccdc171 UTSW 4 83554808 missense probably damaging 0.99
R4502:Ccdc171 UTSW 4 83864323 missense probably damaging 1.00
R4503:Ccdc171 UTSW 4 83864323 missense probably damaging 1.00
R4533:Ccdc171 UTSW 4 83657342 missense possibly damaging 0.66
R4589:Ccdc171 UTSW 4 83549618 missense probably benign 0.11
R4782:Ccdc171 UTSW 4 83681016 missense probably damaging 0.99
R4815:Ccdc171 UTSW 4 83795221 missense probably damaging 1.00
R4868:Ccdc171 UTSW 4 83694332 missense probably damaging 1.00
R4926:Ccdc171 UTSW 4 83558592 intron probably benign
R4937:Ccdc171 UTSW 4 83549639 missense probably damaging 1.00
R5120:Ccdc171 UTSW 4 83558526 intron probably benign
R5210:Ccdc171 UTSW 4 83554856 missense probably damaging 1.00
R5243:Ccdc171 UTSW 4 83604107 missense probably damaging 1.00
R5484:Ccdc171 UTSW 4 83693962 missense probably benign 0.00
R5574:Ccdc171 UTSW 4 83693753 missense probably damaging 1.00
R6053:Ccdc171 UTSW 4 83795219 missense probably damaging 1.00
R6135:Ccdc171 UTSW 4 83554850 missense probably benign 0.12
R6140:Ccdc171 UTSW 4 83696317 nonsense probably null
R6339:Ccdc171 UTSW 4 83742997 missense probably damaging 1.00
R6452:Ccdc171 UTSW 4 83864290 missense probably damaging 1.00
R7111:Ccdc171 UTSW 4 83693761 missense probably benign 0.00
R7352:Ccdc171 UTSW 4 83818023 missense possibly damaging 0.82
R7390:Ccdc171 UTSW 4 83818067 missense probably damaging 1.00
R7626:Ccdc171 UTSW 4 83580775 nonsense probably null
R7686:Ccdc171 UTSW 4 83657319 missense unknown
R7705:Ccdc171 UTSW 4 83557956 missense possibly damaging 0.87
R8058:Ccdc171 UTSW 4 83580766 missense probably damaging 0.99
U24488:Ccdc171 UTSW 4 83661717 missense probably damaging 1.00
Z1176:Ccdc171 UTSW 4 83795230 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTGATAGGTCATCCACAGATTCG -3'
(R):5'- ATGGGAATGGTTGGTTAAACGC -3'

Sequencing Primer
(F):5'- GGTCATCCACAGATTCGAAGTCATG -3'
(R):5'- TTGGTTAAACGCAGCGGC -3'
Posted On2016-07-06