Incidental Mutation 'R5185:Olfr58'
ID397822
Institutional Source Beutler Lab
Gene Symbol Olfr58
Ensembl Gene ENSMUSG00000058659
Gene Nameolfactory receptor 58
SynonymsIG6, MOR146-7P, MOR146-3, GA_x6K02T2PVTD-13523015-13523944
MMRRC Submission 042764-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5185 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location19780283-19785333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19783376 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 81 (M81T)
Ref Sequence ENSEMBL: ENSMUSP00000150309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079660] [ENSMUST00000212363] [ENSMUST00000215112]
Predicted Effect probably damaging
Transcript: ENSMUST00000079660
AA Change: M81T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078603
Gene: ENSMUSG00000063842
AA Change: M81T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.3e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 303 8.3e-8 PFAM
Pfam:7tm_1 41 290 4.5e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000212363
AA Change: M43T

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect probably damaging
Transcript: ENSMUST00000215112
AA Change: M81T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Meta Mutation Damage Score 0.4321 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 95% (70/74)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf2 T C 11: 94,562,911 Y408C probably damaging Het
Aox4 T C 1: 58,254,318 L943S probably damaging Het
Ap1g1 G A 8: 109,863,326 probably benign Het
Arsb T C 13: 93,794,159 S212P probably damaging Het
Arsi A G 18: 60,916,912 N289S probably damaging Het
Atp6v1h T A 1: 5,095,642 F72I probably damaging Het
Atxn7 T C 14: 14,090,063 I336T probably benign Het
Bak1 G A 17: 27,022,748 P65L possibly damaging Het
Bcl6 A T 16: 23,972,947 M219K possibly damaging Het
Brd3 T C 2: 27,462,448 K157E probably damaging Het
Ccdc171 T G 4: 83,663,655 S674A possibly damaging Het
Cfap43 A G 19: 47,780,394 I737T probably benign Het
Cul9 A T 17: 46,525,832 V1089D possibly damaging Het
Dffa C A 4: 149,117,430 A155E probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Efcab12 T A 6: 115,823,490 M191L probably benign Het
Efl1 T C 7: 82,772,499 L1018P probably damaging Het
Fcho1 A G 8: 71,714,956 probably benign Het
Fndc3b T A 3: 27,457,070 T764S probably benign Het
Gm29125 T C 1: 80,384,231 noncoding transcript Het
Gm5108 A G 5: 67,944,610 probably benign Het
Gm9949 T G 18: 62,180,565 probably benign Het
Golgb1 T C 16: 36,875,141 probably benign Het
Gpd2 T C 2: 57,340,204 Y323H probably damaging Het
Grip1 T G 10: 119,931,259 D96E probably benign Het
Hmcn1 T C 1: 150,656,741 I3132V probably benign Het
Hsd17b1 T C 11: 101,080,198 W327R possibly damaging Het
Htra2 G A 6: 83,054,242 P62L probably benign Het
Kdr A T 5: 75,952,417 probably null Het
Kif14 T A 1: 136,527,469 C1626* probably null Het
Kmt2a A T 9: 44,820,246 probably benign Het
Krt15 T C 11: 100,133,433 T321A probably damaging Het
Lactbl1 A T 4: 136,631,045 H109L probably benign Het
Lilra6 T A 7: 3,914,636 H120L probably benign Het
Lpcat2 G A 8: 92,869,737 S134N probably benign Het
Mpp4 T C 1: 59,125,583 D465G probably benign Het
Naip2 A T 13: 100,189,351 D16E probably damaging Het
Nek5 C T 8: 22,083,381 A520T possibly damaging Het
Nfatc2 A G 2: 168,570,707 F132L possibly damaging Het
Nlrp3 C A 11: 59,565,084 T902N probably benign Het
Olfr1097 T C 2: 86,890,602 D191G probably benign Het
Olfr1230 A T 2: 89,296,387 H294Q probably benign Het
Olfr149 A T 9: 39,701,876 W298R probably benign Het
Pcdhb16 T C 18: 37,480,089 S701P possibly damaging Het
Phf7 A G 14: 31,248,037 probably null Het
Plpp4 G A 7: 129,316,304 V68M probably damaging Het
Pnma2 A T 14: 66,916,129 M1L possibly damaging Het
Pnmal2 A T 7: 16,945,976 D295V probably damaging Het
Rad21l T C 2: 151,657,462 D270G probably benign Het
Ralgapa2 C A 2: 146,388,486 probably null Het
Rasal3 A T 17: 32,396,790 L334Q probably damaging Het
Rfx4 G T 10: 84,863,250 R240L probably damaging Het
Rnf19b T A 4: 129,083,920 C642* probably null Het
Slc28a2 G A 2: 122,458,194 E594K probably benign Het
Spata31 G T 13: 64,917,526 W15L possibly damaging Het
Spink5 T C 18: 44,015,644 S925P probably damaging Het
Svep1 C T 4: 58,084,534 G1865S probably damaging Het
Tg T C 15: 66,773,474 L791P probably damaging Het
Thbs4 A C 13: 92,775,167 V247G probably damaging Het
Tpcn2 A T 7: 145,255,454 F705Y probably damaging Het
Try10 A T 6: 41,356,549 H76L probably damaging Het
Ttn C T 2: 76,939,221 V2695I probably damaging Het
Tut1 C A 19: 8,955,450 T49N probably benign Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Xdh G A 17: 73,925,011 R235C probably damaging Het
Yipf4 A G 17: 74,492,475 D70G probably null Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Other mutations in Olfr58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01461:Olfr58 APN 9 19783949 unclassified probably null
IGL01815:Olfr58 APN 9 19784015 missense probably damaging 1.00
IGL02408:Olfr58 APN 9 19783415 missense probably benign 0.31
IGL02644:Olfr58 APN 9 19783714 missense probably benign 0.30
IGL03243:Olfr58 APN 9 19783268 missense probably damaging 0.99
R0603:Olfr58 UTSW 9 19783939 missense probably damaging 1.00
R2363:Olfr58 UTSW 9 19783596 missense probably benign 0.00
R2570:Olfr58 UTSW 9 19784009 missense probably damaging 1.00
R3890:Olfr58 UTSW 9 19783715 missense probably benign 0.03
R3892:Olfr58 UTSW 9 19783715 missense probably benign 0.03
R4163:Olfr58 UTSW 9 19783790 missense possibly damaging 0.69
R4610:Olfr58 UTSW 9 19783146 nonsense probably null
R4691:Olfr58 UTSW 9 19783382 missense probably benign 0.33
R4707:Olfr58 UTSW 9 19783300 missense probably damaging 1.00
R4825:Olfr58 UTSW 9 19783576 missense possibly damaging 0.74
R4950:Olfr58 UTSW 9 19783731 missense probably benign
R5202:Olfr58 UTSW 9 19783218 missense possibly damaging 0.46
R5439:Olfr58 UTSW 9 19783865 missense probably damaging 1.00
R5669:Olfr58 UTSW 9 19783757 missense probably benign 0.02
R5672:Olfr58 UTSW 9 19783211 missense possibly damaging 0.92
R6038:Olfr58 UTSW 9 19783562 missense probably benign
R6038:Olfr58 UTSW 9 19783562 missense probably benign
R6212:Olfr58 UTSW 9 19783289 missense probably damaging 1.00
R6415:Olfr58 UTSW 9 19783748 missense probably damaging 1.00
R7385:Olfr58 UTSW 9 19783211 missense possibly damaging 0.92
R7669:Olfr58 UTSW 9 19783543 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- ACCCTGAACTGCAGCTCATC -3'
(R):5'- TGCACCTGTGAATCAATGAGACTG -3'

Sequencing Primer
(F):5'- GAACTGCAGCTCATCTTATTTGCAC -3'
(R):5'- TCTACACCGACAAGGATTCAGAATG -3'
Posted On2016-07-06