Incidental Mutation 'R5185:Golgb1'
ID 397840
Institutional Source Beutler Lab
Gene Symbol Golgb1
Ensembl Gene ENSMUSG00000034243
Gene Name golgin B1
Synonyms C130074L01Rik, Gm6840, F730017E11Rik, Giantin, 6330407A06Rik
MMRRC Submission 042764-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.908) question?
Stock # R5185 (G1)
Quality Score 148
Status Validated
Chromosome 16
Chromosomal Location 36695502-36753447 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) T to C at 36695503 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023534] [ENSMUST00000023535] [ENSMUST00000075946] [ENSMUST00000114812] [ENSMUST00000114819] [ENSMUST00000135406] [ENSMUST00000134616]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000023534
AA Change: S1P
SMART Domains Protein: ENSMUSP00000023534
Gene: ENSMUSG00000034243
AA Change: S1P

DomainStartEndE-ValueType
low complexity region 55 99 N/A INTRINSIC
low complexity region 109 126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000023535
SMART Domains Protein: ENSMUSP00000023535
Gene: ENSMUSG00000022837

DomainStartEndE-ValueType
IQ 293 315 5.92e-4 SMART
low complexity region 341 358 N/A INTRINSIC
IQ 386 408 2.66e-6 SMART
low complexity region 428 442 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075946
SMART Domains Protein: ENSMUSP00000075331
Gene: ENSMUSG00000022838

DomainStartEndE-ValueType
low complexity region 44 71 N/A INTRINSIC
low complexity region 117 132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114812
SMART Domains Protein: ENSMUSP00000110460
Gene: ENSMUSG00000034243

DomainStartEndE-ValueType
internal_repeat_2 24 61 6.71e-6 PROSPERO
low complexity region 87 107 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
low complexity region 143 154 N/A INTRINSIC
low complexity region 200 219 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
internal_repeat_3 478 517 6.71e-6 PROSPERO
coiled coil region 522 553 N/A INTRINSIC
internal_repeat_4 586 620 3.05e-5 PROSPERO
coiled coil region 638 1080 N/A INTRINSIC
coiled coil region 1112 1199 N/A INTRINSIC
internal_repeat_4 1212 1247 3.05e-5 PROSPERO
low complexity region 1259 1273 N/A INTRINSIC
internal_repeat_1 1280 1311 3.14e-6 PROSPERO
low complexity region 1316 1328 N/A INTRINSIC
coiled coil region 1361 1714 N/A INTRINSIC
internal_repeat_2 1719 1757 6.71e-6 PROSPERO
internal_repeat_3 1720 1763 6.71e-6 PROSPERO
coiled coil region 1777 1993 N/A INTRINSIC
low complexity region 2250 2265 N/A INTRINSIC
internal_repeat_1 2310 2341 3.14e-6 PROSPERO
low complexity region 2359 2377 N/A INTRINSIC
low complexity region 2497 2508 N/A INTRINSIC
coiled coil region 2734 2786 N/A INTRINSIC
coiled coil region 2813 2902 N/A INTRINSIC
low complexity region 2923 2935 N/A INTRINSIC
coiled coil region 2966 3016 N/A INTRINSIC
coiled coil region 3076 3122 N/A INTRINSIC
transmembrane domain 3174 3196 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114819
SMART Domains Protein: ENSMUSP00000110467
Gene: ENSMUSG00000022837

DomainStartEndE-ValueType
IQ 293 315 5.92e-4 SMART
low complexity region 341 358 N/A INTRINSIC
IQ 386 408 2.66e-6 SMART
low complexity region 428 442 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135406
SMART Domains Protein: ENSMUSP00000115848
Gene: ENSMUSG00000034243

DomainStartEndE-ValueType
coiled coil region 42 107 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134616
SMART Domains Protein: ENSMUSP00000116503
Gene: ENSMUSG00000034243

DomainStartEndE-ValueType
coiled coil region 42 107 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 95% (70/74)
MGI Phenotype PHENOTYPE: Homozygous knockout affects glycosylation of glycoproteins in the extra-cellular matrix of the palatal shelves, resulting in their failure to elevate and fuse, leading to cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, other(2) Gene trapped(5)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf2 T C 11: 94,453,737 (GRCm39) Y408C probably damaging Het
Aox4 T C 1: 58,293,477 (GRCm39) L943S probably damaging Het
Ap1g1 G A 8: 110,589,958 (GRCm39) probably benign Het
Arsb T C 13: 93,930,667 (GRCm39) S212P probably damaging Het
Arsi A G 18: 61,049,984 (GRCm39) N289S probably damaging Het
Atp6v1h T A 1: 5,165,865 (GRCm39) F72I probably damaging Het
Atxn7 T C 14: 14,090,063 (GRCm38) I336T probably benign Het
Bak1 G A 17: 27,241,722 (GRCm39) P65L possibly damaging Het
Bcl6 A T 16: 23,791,697 (GRCm39) M219K possibly damaging Het
Brd3 T C 2: 27,352,460 (GRCm39) K157E probably damaging Het
Ccdc171 T G 4: 83,581,892 (GRCm39) S674A possibly damaging Het
Cfap43 A G 19: 47,768,833 (GRCm39) I737T probably benign Het
Cul9 A T 17: 46,836,758 (GRCm39) V1089D possibly damaging Het
Dffa C A 4: 149,201,887 (GRCm39) A155E probably benign Het
Dnhd1 G A 7: 105,352,416 (GRCm39) R2523Q probably damaging Het
Efcab12 T A 6: 115,800,451 (GRCm39) M191L probably benign Het
Efl1 T C 7: 82,421,707 (GRCm39) L1018P probably damaging Het
Fcho1 A G 8: 72,167,600 (GRCm39) probably benign Het
Fndc3b T A 3: 27,511,219 (GRCm39) T764S probably benign Het
Gm29125 T C 1: 80,361,948 (GRCm39) noncoding transcript Het
Gm5108 A G 5: 68,101,953 (GRCm39) probably benign Het
Gm9949 T G 18: 62,313,636 (GRCm39) probably benign Het
Gpd2 T C 2: 57,230,216 (GRCm39) Y323H probably damaging Het
Grip1 T G 10: 119,767,164 (GRCm39) D96E probably benign Het
Hmcn1 T C 1: 150,532,492 (GRCm39) I3132V probably benign Het
Hsd17b1 T C 11: 100,971,024 (GRCm39) W327R possibly damaging Het
Htra2 G A 6: 83,031,223 (GRCm39) P62L probably benign Het
Kdr A T 5: 76,113,077 (GRCm39) probably null Het
Kif14 T A 1: 136,455,207 (GRCm39) C1626* probably null Het
Kmt2a A T 9: 44,731,543 (GRCm39) probably benign Het
Krt15 T C 11: 100,024,259 (GRCm39) T321A probably damaging Het
Lactbl1 A T 4: 136,358,356 (GRCm39) H109L probably benign Het
Lilra6 T A 7: 3,917,635 (GRCm39) H120L probably benign Het
Lpcat2 G A 8: 93,596,365 (GRCm39) S134N probably benign Het
Mpp4 T C 1: 59,164,742 (GRCm39) D465G probably benign Het
Naip2 A T 13: 100,325,859 (GRCm39) D16E probably damaging Het
Nek5 C T 8: 22,573,397 (GRCm39) A520T possibly damaging Het
Nfatc2 A G 2: 168,412,627 (GRCm39) F132L possibly damaging Het
Nlrp3 C A 11: 59,455,910 (GRCm39) T902N probably benign Het
Or10d1b A T 9: 39,613,172 (GRCm39) W298R probably benign Het
Or4c123 A T 2: 89,126,731 (GRCm39) H294Q probably benign Het
Or7e165 T C 9: 19,694,672 (GRCm39) M81T probably damaging Het
Or8h7 T C 2: 86,720,946 (GRCm39) D191G probably benign Het
Pcdhb16 T C 18: 37,613,142 (GRCm39) S701P possibly damaging Het
Phf7 A G 14: 30,969,994 (GRCm39) probably null Het
Plpp4 G A 7: 128,918,028 (GRCm39) V68M probably damaging Het
Pnma2 A T 14: 67,153,578 (GRCm39) M1L possibly damaging Het
Pnma8b A T 7: 16,679,901 (GRCm39) D295V probably damaging Het
Rad21l T C 2: 151,499,382 (GRCm39) D270G probably benign Het
Ralgapa2 C A 2: 146,230,406 (GRCm39) probably null Het
Rasal3 A T 17: 32,615,764 (GRCm39) L334Q probably damaging Het
Rfx4 G T 10: 84,699,114 (GRCm39) R240L probably damaging Het
Rnf19b T A 4: 128,977,713 (GRCm39) C642* probably null Het
Slc28a2 G A 2: 122,288,675 (GRCm39) E594K probably benign Het
Spata31 G T 13: 65,065,340 (GRCm39) W15L possibly damaging Het
Spink5 T C 18: 44,148,711 (GRCm39) S925P probably damaging Het
Svep1 C T 4: 58,084,534 (GRCm39) G1865S probably damaging Het
Tg T C 15: 66,645,323 (GRCm39) L791P probably damaging Het
Thbs4 A C 13: 92,911,675 (GRCm39) V247G probably damaging Het
Tpcn2 A T 7: 144,809,191 (GRCm39) F705Y probably damaging Het
Try10 A T 6: 41,333,483 (GRCm39) H76L probably damaging Het
Ttn C T 2: 76,769,565 (GRCm39) V2695I probably damaging Het
Tut1 C A 19: 8,932,814 (GRCm39) T49N probably benign Het
Vmn1r17 A G 6: 57,337,828 (GRCm39) V130A probably benign Het
Xdh G A 17: 74,232,006 (GRCm39) R235C probably damaging Het
Yipf4 A G 17: 74,799,470 (GRCm39) D70G probably null Het
Zfp108 G T 7: 23,960,163 (GRCm39) K251N probably benign Het
Other mutations in Golgb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Golgb1 APN 16 36,751,926 (GRCm39) missense probably damaging 1.00
IGL01717:Golgb1 APN 16 36,735,864 (GRCm39) nonsense probably null
IGL01965:Golgb1 APN 16 36,738,282 (GRCm39) missense probably damaging 1.00
IGL02128:Golgb1 APN 16 36,736,666 (GRCm39) missense probably damaging 1.00
IGL02268:Golgb1 APN 16 36,733,490 (GRCm39) missense probably benign 0.25
IGL02383:Golgb1 APN 16 36,706,562 (GRCm39) missense probably benign 0.01
IGL02444:Golgb1 APN 16 36,728,178 (GRCm39) splice site probably benign
IGL02635:Golgb1 APN 16 36,735,375 (GRCm39) missense probably benign 0.00
IGL02655:Golgb1 APN 16 36,738,442 (GRCm39) missense probably damaging 0.98
IGL02887:Golgb1 APN 16 36,746,211 (GRCm39) missense probably damaging 0.99
IGL02937:Golgb1 APN 16 36,736,572 (GRCm39) missense probably damaging 1.00
IGL02973:Golgb1 APN 16 36,732,442 (GRCm39) missense possibly damaging 0.92
IGL02982:Golgb1 APN 16 36,746,172 (GRCm39) missense probably damaging 0.98
IGL03065:Golgb1 APN 16 36,733,228 (GRCm39) missense probably benign 0.11
IGL03109:Golgb1 APN 16 36,735,973 (GRCm39) missense possibly damaging 0.93
IGL03323:Golgb1 APN 16 36,733,815 (GRCm39) nonsense probably null
I2288:Golgb1 UTSW 16 36,718,904 (GRCm39) missense probably benign 0.00
I2289:Golgb1 UTSW 16 36,718,904 (GRCm39) missense probably benign 0.00
R0071:Golgb1 UTSW 16 36,735,865 (GRCm39) missense probably benign 0.00
R0071:Golgb1 UTSW 16 36,735,865 (GRCm39) missense probably benign 0.00
R0080:Golgb1 UTSW 16 36,718,973 (GRCm39) missense probably damaging 1.00
R0102:Golgb1 UTSW 16 36,695,830 (GRCm39) intron probably benign
R0242:Golgb1 UTSW 16 36,695,992 (GRCm39) nonsense probably null
R0242:Golgb1 UTSW 16 36,695,992 (GRCm39) nonsense probably null
R0276:Golgb1 UTSW 16 36,734,238 (GRCm39) missense probably damaging 1.00
R0394:Golgb1 UTSW 16 36,695,941 (GRCm39) intron probably benign
R0469:Golgb1 UTSW 16 36,751,997 (GRCm39) missense probably benign 0.41
R0522:Golgb1 UTSW 16 36,735,567 (GRCm39) frame shift probably null
R0575:Golgb1 UTSW 16 36,739,171 (GRCm39) missense probably benign
R0600:Golgb1 UTSW 16 36,736,633 (GRCm39) missense probably damaging 1.00
R0608:Golgb1 UTSW 16 36,736,692 (GRCm39) nonsense probably null
R0711:Golgb1 UTSW 16 36,739,152 (GRCm39) missense probably damaging 1.00
R0785:Golgb1 UTSW 16 36,719,152 (GRCm39) missense possibly damaging 0.95
R0893:Golgb1 UTSW 16 36,732,639 (GRCm39) missense possibly damaging 0.64
R1163:Golgb1 UTSW 16 36,736,488 (GRCm39) missense possibly damaging 0.50
R1208:Golgb1 UTSW 16 36,735,567 (GRCm39) frame shift probably null
R1315:Golgb1 UTSW 16 36,735,262 (GRCm39) missense probably benign 0.40
R1429:Golgb1 UTSW 16 36,720,925 (GRCm39) missense possibly damaging 0.93
R1505:Golgb1 UTSW 16 36,740,005 (GRCm39) missense possibly damaging 0.79
R1537:Golgb1 UTSW 16 36,719,150 (GRCm39) missense possibly damaging 0.89
R1610:Golgb1 UTSW 16 36,746,463 (GRCm39) missense probably benign 0.25
R1659:Golgb1 UTSW 16 36,707,979 (GRCm39) missense probably benign 0.01
R1769:Golgb1 UTSW 16 36,736,363 (GRCm39) missense probably damaging 1.00
R2105:Golgb1 UTSW 16 36,735,026 (GRCm39) missense probably benign
R2212:Golgb1 UTSW 16 36,707,709 (GRCm39) missense probably damaging 1.00
R2261:Golgb1 UTSW 16 36,713,722 (GRCm39) missense probably damaging 1.00
R2352:Golgb1 UTSW 16 36,718,921 (GRCm39) missense probably damaging 0.99
R2357:Golgb1 UTSW 16 36,732,370 (GRCm39) missense probably damaging 1.00
R2400:Golgb1 UTSW 16 36,738,828 (GRCm39) missense possibly damaging 0.62
R2513:Golgb1 UTSW 16 36,735,513 (GRCm39) missense possibly damaging 0.73
R3103:Golgb1 UTSW 16 36,715,211 (GRCm39) missense probably damaging 1.00
R3413:Golgb1 UTSW 16 36,707,709 (GRCm39) missense probably damaging 1.00
R3748:Golgb1 UTSW 16 36,739,274 (GRCm39) missense probably benign 0.00
R3847:Golgb1 UTSW 16 36,719,095 (GRCm39) missense probably benign 0.00
R3850:Golgb1 UTSW 16 36,719,095 (GRCm39) missense probably benign 0.00
R3936:Golgb1 UTSW 16 36,734,418 (GRCm39) nonsense probably null
R3975:Golgb1 UTSW 16 36,738,933 (GRCm39) missense probably damaging 0.99
R4025:Golgb1 UTSW 16 36,735,706 (GRCm39) missense probably benign 0.00
R4369:Golgb1 UTSW 16 36,737,269 (GRCm39) missense probably damaging 1.00
R4518:Golgb1 UTSW 16 36,749,625 (GRCm39) missense probably damaging 0.98
R4600:Golgb1 UTSW 16 36,738,987 (GRCm39) missense probably damaging 1.00
R4610:Golgb1 UTSW 16 36,738,987 (GRCm39) missense probably damaging 1.00
R4660:Golgb1 UTSW 16 36,707,980 (GRCm39) missense probably damaging 0.99
R4811:Golgb1 UTSW 16 36,711,781 (GRCm39) missense probably damaging 1.00
R4815:Golgb1 UTSW 16 36,733,477 (GRCm39) missense possibly damaging 0.79
R4835:Golgb1 UTSW 16 36,711,769 (GRCm39) missense possibly damaging 0.86
R4904:Golgb1 UTSW 16 36,713,748 (GRCm39) missense probably damaging 1.00
R4916:Golgb1 UTSW 16 36,736,480 (GRCm39) missense probably benign 0.05
R5121:Golgb1 UTSW 16 36,739,620 (GRCm39) missense probably damaging 0.99
R5133:Golgb1 UTSW 16 36,711,819 (GRCm39) missense possibly damaging 0.75
R5143:Golgb1 UTSW 16 36,719,051 (GRCm39) missense probably benign 0.09
R5188:Golgb1 UTSW 16 36,738,827 (GRCm39) missense probably benign 0.13
R5260:Golgb1 UTSW 16 36,733,503 (GRCm39) missense probably benign 0.00
R5297:Golgb1 UTSW 16 36,695,978 (GRCm39) intron probably benign
R5386:Golgb1 UTSW 16 36,732,677 (GRCm39) nonsense probably null
R5438:Golgb1 UTSW 16 36,720,870 (GRCm39) missense probably benign 0.15
R5439:Golgb1 UTSW 16 36,720,870 (GRCm39) missense probably benign 0.15
R5494:Golgb1 UTSW 16 36,749,045 (GRCm39) missense possibly damaging 0.67
R5592:Golgb1 UTSW 16 36,746,125 (GRCm39) missense probably benign 0.02
R5740:Golgb1 UTSW 16 36,739,362 (GRCm39) missense probably damaging 0.99
R5862:Golgb1 UTSW 16 36,746,453 (GRCm39) splice site silent
R5928:Golgb1 UTSW 16 36,732,349 (GRCm39) missense probably damaging 1.00
R6009:Golgb1 UTSW 16 36,735,321 (GRCm39) missense probably damaging 1.00
R6062:Golgb1 UTSW 16 36,735,033 (GRCm39) missense possibly damaging 0.89
R6102:Golgb1 UTSW 16 36,733,227 (GRCm39) missense probably damaging 1.00
R6198:Golgb1 UTSW 16 36,713,757 (GRCm39) missense probably damaging 1.00
R6253:Golgb1 UTSW 16 36,735,984 (GRCm39) missense possibly damaging 0.77
R6254:Golgb1 UTSW 16 36,734,340 (GRCm39) missense probably damaging 0.99
R6321:Golgb1 UTSW 16 36,738,559 (GRCm39) nonsense probably null
R6700:Golgb1 UTSW 16 36,695,946 (GRCm39) intron probably benign
R6870:Golgb1 UTSW 16 36,738,565 (GRCm39) missense probably damaging 1.00
R6882:Golgb1 UTSW 16 36,734,352 (GRCm39) missense probably benign
R6944:Golgb1 UTSW 16 36,732,475 (GRCm39) missense probably benign
R7108:Golgb1 UTSW 16 36,734,083 (GRCm39) missense probably benign 0.01
R7124:Golgb1 UTSW 16 36,734,035 (GRCm39) missense probably benign 0.01
R7125:Golgb1 UTSW 16 36,738,325 (GRCm39) missense possibly damaging 0.85
R7187:Golgb1 UTSW 16 36,736,512 (GRCm39) missense probably benign 0.43
R7205:Golgb1 UTSW 16 36,695,663 (GRCm39) missense unknown
R7206:Golgb1 UTSW 16 36,734,111 (GRCm39) missense probably benign 0.41
R7233:Golgb1 UTSW 16 36,735,120 (GRCm39) missense possibly damaging 0.91
R7320:Golgb1 UTSW 16 36,736,313 (GRCm39) nonsense probably null
R7367:Golgb1 UTSW 16 36,718,908 (GRCm39) missense probably benign 0.00
R7408:Golgb1 UTSW 16 36,718,909 (GRCm39) missense probably damaging 0.98
R7419:Golgb1 UTSW 16 36,733,281 (GRCm39) missense possibly damaging 0.95
R7556:Golgb1 UTSW 16 36,736,155 (GRCm39) missense probably benign 0.03
R7599:Golgb1 UTSW 16 36,695,758 (GRCm39) missense unknown
R7673:Golgb1 UTSW 16 36,734,031 (GRCm39) missense probably benign 0.05
R7789:Golgb1 UTSW 16 36,695,761 (GRCm39) missense unknown
R7792:Golgb1 UTSW 16 36,739,092 (GRCm39) missense probably benign 0.43
R7830:Golgb1 UTSW 16 36,719,083 (GRCm39) missense possibly damaging 0.93
R7847:Golgb1 UTSW 16 36,752,282 (GRCm39) missense probably damaging 1.00
R7905:Golgb1 UTSW 16 36,734,047 (GRCm39) missense probably benign
R7944:Golgb1 UTSW 16 36,734,466 (GRCm39) missense probably benign 0.02
R7945:Golgb1 UTSW 16 36,734,466 (GRCm39) missense probably benign 0.02
R7950:Golgb1 UTSW 16 36,735,786 (GRCm39) missense probably benign 0.13
R8040:Golgb1 UTSW 16 36,733,841 (GRCm39) missense possibly damaging 0.85
R8077:Golgb1 UTSW 16 36,738,995 (GRCm39) missense probably damaging 0.99
R8181:Golgb1 UTSW 16 36,737,192 (GRCm39) missense probably damaging 1.00
R8370:Golgb1 UTSW 16 36,732,679 (GRCm39) missense probably benign 0.00
R8684:Golgb1 UTSW 16 36,734,764 (GRCm39) missense possibly damaging 0.92
R8725:Golgb1 UTSW 16 36,739,563 (GRCm39) missense probably damaging 1.00
R8727:Golgb1 UTSW 16 36,739,563 (GRCm39) missense probably damaging 1.00
R8738:Golgb1 UTSW 16 36,736,675 (GRCm39) missense probably damaging 1.00
R8785:Golgb1 UTSW 16 36,740,106 (GRCm39) missense probably damaging 0.99
R8824:Golgb1 UTSW 16 36,736,051 (GRCm39) missense probably benign
R8825:Golgb1 UTSW 16 36,739,809 (GRCm39) missense probably benign 0.00
R8940:Golgb1 UTSW 16 36,736,759 (GRCm39) missense probably damaging 1.00
R8962:Golgb1 UTSW 16 36,733,978 (GRCm39) missense probably damaging 1.00
R9245:Golgb1 UTSW 16 36,739,181 (GRCm39) nonsense probably null
R9365:Golgb1 UTSW 16 36,736,124 (GRCm39) missense probably damaging 1.00
R9612:Golgb1 UTSW 16 36,739,967 (GRCm39) missense probably benign 0.41
R9620:Golgb1 UTSW 16 36,739,811 (GRCm39) missense probably benign
R9691:Golgb1 UTSW 16 36,718,996 (GRCm39) missense probably damaging 1.00
R9747:Golgb1 UTSW 16 36,713,769 (GRCm39) missense probably damaging 1.00
V1662:Golgb1 UTSW 16 36,718,904 (GRCm39) missense probably benign 0.00
X0067:Golgb1 UTSW 16 36,734,665 (GRCm39) nonsense probably null
Z1088:Golgb1 UTSW 16 36,740,104 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCACGTCCTTCTTAGAATCC -3'
(R):5'- CACTAAGTTTGTTCAGGGCTG -3'

Sequencing Primer
(F):5'- TAGAATCCATTGGCTCCGTCTTTGAG -3'
(R):5'- GCAGACTGACTGGGTGTC -3'
Posted On 2016-07-06