Incidental Mutation 'R5185:Xdh'
ID397844
Institutional Source Beutler Lab
Gene Symbol Xdh
Ensembl Gene ENSMUSG00000024066
Gene Namexanthine dehydrogenase
Synonymsxanthine oxidase, XO, Xor, Xox1, Xox-1
MMRRC Submission 042764-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.481) question?
Stock #R5185 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location73883908-73950182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 73925011 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 235 (R235C)
Ref Sequence ENSEMBL: ENSMUSP00000024866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024866]
Predicted Effect probably damaging
Transcript: ENSMUST00000024866
AA Change: R235C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: R235C

DomainStartEndE-ValueType
Pfam:Fer2 11 81 5e-12 PFAM
Pfam:Fer2_2 90 163 4.1e-31 PFAM
low complexity region 169 182 N/A INTRINSIC
Pfam:FAD_binding_5 234 414 4.9e-47 PFAM
CO_deh_flav_C 421 525 1.16e-24 SMART
Ald_Xan_dh_C 590 696 1.23e-46 SMART
Pfam:Ald_Xan_dh_C2 704 1239 1e-200 PFAM
Meta Mutation Damage Score 0.5265 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 95% (70/74)
MGI Phenotype FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf2 T C 11: 94,562,911 Y408C probably damaging Het
Aox4 T C 1: 58,254,318 L943S probably damaging Het
Ap1g1 G A 8: 109,863,326 probably benign Het
Arsb T C 13: 93,794,159 S212P probably damaging Het
Arsi A G 18: 60,916,912 N289S probably damaging Het
Atp6v1h T A 1: 5,095,642 F72I probably damaging Het
Atxn7 T C 14: 14,090,063 I336T probably benign Het
Bak1 G A 17: 27,022,748 P65L possibly damaging Het
Bcl6 A T 16: 23,972,947 M219K possibly damaging Het
Brd3 T C 2: 27,462,448 K157E probably damaging Het
Ccdc171 T G 4: 83,663,655 S674A possibly damaging Het
Cfap43 A G 19: 47,780,394 I737T probably benign Het
Cul9 A T 17: 46,525,832 V1089D possibly damaging Het
Dffa C A 4: 149,117,430 A155E probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Efcab12 T A 6: 115,823,490 M191L probably benign Het
Efl1 T C 7: 82,772,499 L1018P probably damaging Het
Fcho1 A G 8: 71,714,956 probably benign Het
Fndc3b T A 3: 27,457,070 T764S probably benign Het
Gm29125 T C 1: 80,384,231 noncoding transcript Het
Gm5108 A G 5: 67,944,610 probably benign Het
Gm9949 T G 18: 62,180,565 probably benign Het
Golgb1 T C 16: 36,875,141 probably benign Het
Gpd2 T C 2: 57,340,204 Y323H probably damaging Het
Grip1 T G 10: 119,931,259 D96E probably benign Het
Hmcn1 T C 1: 150,656,741 I3132V probably benign Het
Hsd17b1 T C 11: 101,080,198 W327R possibly damaging Het
Htra2 G A 6: 83,054,242 P62L probably benign Het
Kdr A T 5: 75,952,417 probably null Het
Kif14 T A 1: 136,527,469 C1626* probably null Het
Kmt2a A T 9: 44,820,246 probably benign Het
Krt15 T C 11: 100,133,433 T321A probably damaging Het
Lactbl1 A T 4: 136,631,045 H109L probably benign Het
Lilra6 T A 7: 3,914,636 H120L probably benign Het
Lpcat2 G A 8: 92,869,737 S134N probably benign Het
Mpp4 T C 1: 59,125,583 D465G probably benign Het
Naip2 A T 13: 100,189,351 D16E probably damaging Het
Nek5 C T 8: 22,083,381 A520T possibly damaging Het
Nfatc2 A G 2: 168,570,707 F132L possibly damaging Het
Nlrp3 C A 11: 59,565,084 T902N probably benign Het
Olfr1097 T C 2: 86,890,602 D191G probably benign Het
Olfr1230 A T 2: 89,296,387 H294Q probably benign Het
Olfr149 A T 9: 39,701,876 W298R probably benign Het
Olfr58 T C 9: 19,783,376 M81T probably damaging Het
Pcdhb16 T C 18: 37,480,089 S701P possibly damaging Het
Phf7 A G 14: 31,248,037 probably null Het
Plpp4 G A 7: 129,316,304 V68M probably damaging Het
Pnma2 A T 14: 66,916,129 M1L possibly damaging Het
Pnmal2 A T 7: 16,945,976 D295V probably damaging Het
Rad21l T C 2: 151,657,462 D270G probably benign Het
Ralgapa2 C A 2: 146,388,486 probably null Het
Rasal3 A T 17: 32,396,790 L334Q probably damaging Het
Rfx4 G T 10: 84,863,250 R240L probably damaging Het
Rnf19b T A 4: 129,083,920 C642* probably null Het
Slc28a2 G A 2: 122,458,194 E594K probably benign Het
Spata31 G T 13: 64,917,526 W15L possibly damaging Het
Spink5 T C 18: 44,015,644 S925P probably damaging Het
Svep1 C T 4: 58,084,534 G1865S probably damaging Het
Tg T C 15: 66,773,474 L791P probably damaging Het
Thbs4 A C 13: 92,775,167 V247G probably damaging Het
Tpcn2 A T 7: 145,255,454 F705Y probably damaging Het
Try10 A T 6: 41,356,549 H76L probably damaging Het
Ttn C T 2: 76,939,221 V2695I probably damaging Het
Tut1 C A 19: 8,955,450 T49N probably benign Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Yipf4 A G 17: 74,492,475 D70G probably null Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Other mutations in Xdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Xdh APN 17 73923106 missense possibly damaging 0.58
IGL00556:Xdh APN 17 73884435 makesense probably null
IGL01524:Xdh APN 17 73923137 critical splice acceptor site probably null
IGL01604:Xdh APN 17 73909337 missense probably benign 0.02
IGL01625:Xdh APN 17 73916786 critical splice donor site probably null
IGL01778:Xdh APN 17 73900280 missense probably benign 0.00
IGL01804:Xdh APN 17 73892759 missense probably damaging 1.00
IGL01825:Xdh APN 17 73891245 missense probably damaging 1.00
IGL01929:Xdh APN 17 73934855 missense probably damaging 1.00
IGL02068:Xdh APN 17 73913950 missense probably damaging 1.00
IGL02079:Xdh APN 17 73891277 missense probably damaging 1.00
IGL02210:Xdh APN 17 73943895 missense probably benign 0.00
IGL02261:Xdh APN 17 73913965 missense possibly damaging 0.81
IGL02365:Xdh APN 17 73943890 missense probably benign 0.14
IGL02424:Xdh APN 17 73926570 missense probably benign 0.00
IGL02491:Xdh APN 17 73886464 missense probably damaging 0.99
IGL02525:Xdh APN 17 73924995 missense possibly damaging 0.91
IGL02578:Xdh APN 17 73906246 missense probably damaging 1.00
IGL02793:Xdh APN 17 73900581 missense probably damaging 1.00
IGL02939:Xdh APN 17 73943845 critical splice donor site probably null
IGL03327:Xdh APN 17 73916792 missense probably benign
IGL03345:Xdh APN 17 73906032 missense probably damaging 0.98
IGL03353:Xdh APN 17 73895786 missense possibly damaging 0.65
R0018:Xdh UTSW 17 73925025 missense probably benign 0.00
R0018:Xdh UTSW 17 73925025 missense probably benign 0.00
R0033:Xdh UTSW 17 73907632 missense probably benign 0.06
R0079:Xdh UTSW 17 73891218 missense probably damaging 1.00
R0086:Xdh UTSW 17 73884438 missense probably benign
R0319:Xdh UTSW 17 73906101 splice site probably benign
R0336:Xdh UTSW 17 73922463 missense possibly damaging 0.91
R0389:Xdh UTSW 17 73898362 missense probably damaging 1.00
R0684:Xdh UTSW 17 73943891 missense probably damaging 0.97
R0930:Xdh UTSW 17 73923082 missense probably benign 0.00
R1073:Xdh UTSW 17 73939836 missense probably benign
R1114:Xdh UTSW 17 73941149 splice site probably benign
R1201:Xdh UTSW 17 73918418 missense probably benign 0.05
R1230:Xdh UTSW 17 73891256 missense probably damaging 1.00
R1351:Xdh UTSW 17 73923078 missense probably benign 0.02
R1470:Xdh UTSW 17 73891112 missense probably damaging 1.00
R1470:Xdh UTSW 17 73891112 missense probably damaging 1.00
R1485:Xdh UTSW 17 73914019 nonsense probably null
R1548:Xdh UTSW 17 73913901 missense probably damaging 0.98
R1637:Xdh UTSW 17 73900578 missense probably benign
R1641:Xdh UTSW 17 73926552 missense probably benign
R1758:Xdh UTSW 17 73910209 missense probably damaging 1.00
R1951:Xdh UTSW 17 73907658 missense probably damaging 1.00
R1969:Xdh UTSW 17 73892751 missense possibly damaging 0.55
R2024:Xdh UTSW 17 73921305 missense possibly damaging 0.92
R2080:Xdh UTSW 17 73909325 missense probably damaging 1.00
R2157:Xdh UTSW 17 73922537 missense probably damaging 1.00
R2300:Xdh UTSW 17 73891265 missense probably damaging 1.00
R3783:Xdh UTSW 17 73893595 splice site probably benign
R3796:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3797:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3798:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3799:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3819:Xdh UTSW 17 73906725 missense probably benign 0.35
R4085:Xdh UTSW 17 73916879 missense probably benign 0.35
R4240:Xdh UTSW 17 73895795 missense possibly damaging 0.72
R4356:Xdh UTSW 17 73915690 missense probably benign 0.01
R4522:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4523:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4524:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4600:Xdh UTSW 17 73910200 missense probably benign 0.19
R4617:Xdh UTSW 17 73918394 missense probably damaging 0.99
R4756:Xdh UTSW 17 73886386 missense probably benign 0.24
R4761:Xdh UTSW 17 73910267 missense possibly damaging 0.91
R4815:Xdh UTSW 17 73906215 missense probably damaging 1.00
R4850:Xdh UTSW 17 73898335 missense probably damaging 1.00
R4896:Xdh UTSW 17 73910243 missense probably damaging 0.96
R4897:Xdh UTSW 17 73900708 missense probably benign
R4923:Xdh UTSW 17 73924936 missense possibly damaging 0.72
R4977:Xdh UTSW 17 73898970 missense probably benign 0.05
R5030:Xdh UTSW 17 73891293 missense probably damaging 1.00
R5347:Xdh UTSW 17 73925032 missense probably benign
R5556:Xdh UTSW 17 73897764 missense probably benign 0.21
R5566:Xdh UTSW 17 73893622 missense probably damaging 1.00
R5568:Xdh UTSW 17 73943885 missense possibly damaging 0.90
R5635:Xdh UTSW 17 73913875 missense possibly damaging 0.92
R5662:Xdh UTSW 17 73941115 missense probably damaging 0.99
R5955:Xdh UTSW 17 73898320 missense probably damaging 1.00
R6058:Xdh UTSW 17 73906269 missense probably damaging 1.00
R6061:Xdh UTSW 17 73921347 missense probably damaging 1.00
R6412:Xdh UTSW 17 73935907 missense probably benign 0.09
R6526:Xdh UTSW 17 73900551 missense probably damaging 0.97
R6558:Xdh UTSW 17 73893713 missense possibly damaging 0.95
R6843:Xdh UTSW 17 73923130 missense probably damaging 1.00
R6932:Xdh UTSW 17 73922562 missense probably damaging 0.99
R7028:Xdh UTSW 17 73943873 missense probably damaging 0.99
R7418:Xdh UTSW 17 73913965 missense possibly damaging 0.81
R7503:Xdh UTSW 17 73926210 missense probably damaging 1.00
R7653:Xdh UTSW 17 73897045 missense probably benign 0.10
R7763:Xdh UTSW 17 73934834 missense possibly damaging 0.69
R7768:Xdh UTSW 17 73939836 missense probably benign
R7904:Xdh UTSW 17 73922472 missense probably benign 0.09
R8010:Xdh UTSW 17 73909317 nonsense probably null
R8067:Xdh UTSW 17 73900657 missense probably benign 0.01
R8238:Xdh UTSW 17 73886417 missense probably benign
R8253:Xdh UTSW 17 73918382 missense possibly damaging 0.94
R8346:Xdh UTSW 17 73913943 missense probably damaging 1.00
R8381:Xdh UTSW 17 73912461 missense probably benign
R8427:Xdh UTSW 17 73935931 missense probably damaging 1.00
X0019:Xdh UTSW 17 73918454 missense probably damaging 1.00
Z1088:Xdh UTSW 17 73886428 missense probably benign
Z1176:Xdh UTSW 17 73923042 critical splice donor site probably null
Z1177:Xdh UTSW 17 73897695 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACTGAGATCATTGTGTTCC -3'
(R):5'- ATGTGCAGCTCTTCCTTCTGAG -3'

Sequencing Primer
(F):5'- ACTGAGATCATTGTGTTCCTCTTAG -3'
(R):5'- CCTTCTGAGTTCAGTTTTACACAAG -3'
Posted On2016-07-06