Incidental Mutation 'R5185:Xdh'
ID 397844
Institutional Source Beutler Lab
Gene Symbol Xdh
Ensembl Gene ENSMUSG00000024066
Gene Name xanthine dehydrogenase
Synonyms Xox-1, XO, Xor, Xox1, xanthine oxidase
MMRRC Submission 042764-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.430) question?
Stock # R5185 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 74190890-74257191 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 74232006 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 235 (R235C)
Ref Sequence ENSEMBL: ENSMUSP00000024866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024866]
AlphaFold Q00519
Predicted Effect probably damaging
Transcript: ENSMUST00000024866
AA Change: R235C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: R235C

DomainStartEndE-ValueType
Pfam:Fer2 11 81 5e-12 PFAM
Pfam:Fer2_2 90 163 4.1e-31 PFAM
low complexity region 169 182 N/A INTRINSIC
Pfam:FAD_binding_5 234 414 4.9e-47 PFAM
CO_deh_flav_C 421 525 1.16e-24 SMART
Ald_Xan_dh_C 590 696 1.23e-46 SMART
Pfam:Ald_Xan_dh_C2 704 1239 1e-200 PFAM
Meta Mutation Damage Score 0.5265 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 95% (70/74)
MGI Phenotype FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf2 T C 11: 94,453,737 (GRCm39) Y408C probably damaging Het
Aox4 T C 1: 58,293,477 (GRCm39) L943S probably damaging Het
Ap1g1 G A 8: 110,589,958 (GRCm39) probably benign Het
Arsb T C 13: 93,930,667 (GRCm39) S212P probably damaging Het
Arsi A G 18: 61,049,984 (GRCm39) N289S probably damaging Het
Atp6v1h T A 1: 5,165,865 (GRCm39) F72I probably damaging Het
Atxn7 T C 14: 14,090,063 (GRCm38) I336T probably benign Het
Bak1 G A 17: 27,241,722 (GRCm39) P65L possibly damaging Het
Bcl6 A T 16: 23,791,697 (GRCm39) M219K possibly damaging Het
Brd3 T C 2: 27,352,460 (GRCm39) K157E probably damaging Het
Ccdc171 T G 4: 83,581,892 (GRCm39) S674A possibly damaging Het
Cfap43 A G 19: 47,768,833 (GRCm39) I737T probably benign Het
Cul9 A T 17: 46,836,758 (GRCm39) V1089D possibly damaging Het
Dffa C A 4: 149,201,887 (GRCm39) A155E probably benign Het
Dnhd1 G A 7: 105,352,416 (GRCm39) R2523Q probably damaging Het
Efcab12 T A 6: 115,800,451 (GRCm39) M191L probably benign Het
Efl1 T C 7: 82,421,707 (GRCm39) L1018P probably damaging Het
Fcho1 A G 8: 72,167,600 (GRCm39) probably benign Het
Fndc3b T A 3: 27,511,219 (GRCm39) T764S probably benign Het
Gm29125 T C 1: 80,361,948 (GRCm39) noncoding transcript Het
Gm5108 A G 5: 68,101,953 (GRCm39) probably benign Het
Gm9949 T G 18: 62,313,636 (GRCm39) probably benign Het
Golgb1 T C 16: 36,695,503 (GRCm39) probably benign Het
Gpd2 T C 2: 57,230,216 (GRCm39) Y323H probably damaging Het
Grip1 T G 10: 119,767,164 (GRCm39) D96E probably benign Het
Hmcn1 T C 1: 150,532,492 (GRCm39) I3132V probably benign Het
Hsd17b1 T C 11: 100,971,024 (GRCm39) W327R possibly damaging Het
Htra2 G A 6: 83,031,223 (GRCm39) P62L probably benign Het
Kdr A T 5: 76,113,077 (GRCm39) probably null Het
Kif14 T A 1: 136,455,207 (GRCm39) C1626* probably null Het
Kmt2a A T 9: 44,731,543 (GRCm39) probably benign Het
Krt15 T C 11: 100,024,259 (GRCm39) T321A probably damaging Het
Lactbl1 A T 4: 136,358,356 (GRCm39) H109L probably benign Het
Lilra6 T A 7: 3,917,635 (GRCm39) H120L probably benign Het
Lpcat2 G A 8: 93,596,365 (GRCm39) S134N probably benign Het
Mpp4 T C 1: 59,164,742 (GRCm39) D465G probably benign Het
Naip2 A T 13: 100,325,859 (GRCm39) D16E probably damaging Het
Nek5 C T 8: 22,573,397 (GRCm39) A520T possibly damaging Het
Nfatc2 A G 2: 168,412,627 (GRCm39) F132L possibly damaging Het
Nlrp3 C A 11: 59,455,910 (GRCm39) T902N probably benign Het
Or10d1b A T 9: 39,613,172 (GRCm39) W298R probably benign Het
Or4c123 A T 2: 89,126,731 (GRCm39) H294Q probably benign Het
Or7e165 T C 9: 19,694,672 (GRCm39) M81T probably damaging Het
Or8h7 T C 2: 86,720,946 (GRCm39) D191G probably benign Het
Pcdhb16 T C 18: 37,613,142 (GRCm39) S701P possibly damaging Het
Phf7 A G 14: 30,969,994 (GRCm39) probably null Het
Plpp4 G A 7: 128,918,028 (GRCm39) V68M probably damaging Het
Pnma2 A T 14: 67,153,578 (GRCm39) M1L possibly damaging Het
Pnma8b A T 7: 16,679,901 (GRCm39) D295V probably damaging Het
Rad21l T C 2: 151,499,382 (GRCm39) D270G probably benign Het
Ralgapa2 C A 2: 146,230,406 (GRCm39) probably null Het
Rasal3 A T 17: 32,615,764 (GRCm39) L334Q probably damaging Het
Rfx4 G T 10: 84,699,114 (GRCm39) R240L probably damaging Het
Rnf19b T A 4: 128,977,713 (GRCm39) C642* probably null Het
Slc28a2 G A 2: 122,288,675 (GRCm39) E594K probably benign Het
Spata31 G T 13: 65,065,340 (GRCm39) W15L possibly damaging Het
Spink5 T C 18: 44,148,711 (GRCm39) S925P probably damaging Het
Svep1 C T 4: 58,084,534 (GRCm39) G1865S probably damaging Het
Tg T C 15: 66,645,323 (GRCm39) L791P probably damaging Het
Thbs4 A C 13: 92,911,675 (GRCm39) V247G probably damaging Het
Tpcn2 A T 7: 144,809,191 (GRCm39) F705Y probably damaging Het
Try10 A T 6: 41,333,483 (GRCm39) H76L probably damaging Het
Ttn C T 2: 76,769,565 (GRCm39) V2695I probably damaging Het
Tut1 C A 19: 8,932,814 (GRCm39) T49N probably benign Het
Vmn1r17 A G 6: 57,337,828 (GRCm39) V130A probably benign Het
Yipf4 A G 17: 74,799,470 (GRCm39) D70G probably null Het
Zfp108 G T 7: 23,960,163 (GRCm39) K251N probably benign Het
Other mutations in Xdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Xdh APN 17 74,230,101 (GRCm39) missense possibly damaging 0.58
IGL00556:Xdh APN 17 74,191,430 (GRCm39) makesense probably null
IGL01524:Xdh APN 17 74,230,132 (GRCm39) critical splice acceptor site probably null
IGL01604:Xdh APN 17 74,216,332 (GRCm39) missense probably benign 0.02
IGL01625:Xdh APN 17 74,223,781 (GRCm39) critical splice donor site probably null
IGL01778:Xdh APN 17 74,207,275 (GRCm39) missense probably benign 0.00
IGL01804:Xdh APN 17 74,199,754 (GRCm39) missense probably damaging 1.00
IGL01825:Xdh APN 17 74,198,240 (GRCm39) missense probably damaging 1.00
IGL01929:Xdh APN 17 74,241,850 (GRCm39) missense probably damaging 1.00
IGL02068:Xdh APN 17 74,220,945 (GRCm39) missense probably damaging 1.00
IGL02079:Xdh APN 17 74,198,272 (GRCm39) missense probably damaging 1.00
IGL02210:Xdh APN 17 74,250,890 (GRCm39) missense probably benign 0.00
IGL02261:Xdh APN 17 74,220,960 (GRCm39) missense possibly damaging 0.81
IGL02365:Xdh APN 17 74,250,885 (GRCm39) missense probably benign 0.14
IGL02424:Xdh APN 17 74,233,565 (GRCm39) missense probably benign 0.00
IGL02491:Xdh APN 17 74,193,459 (GRCm39) missense probably damaging 0.99
IGL02525:Xdh APN 17 74,231,990 (GRCm39) missense possibly damaging 0.91
IGL02578:Xdh APN 17 74,213,241 (GRCm39) missense probably damaging 1.00
IGL02793:Xdh APN 17 74,207,576 (GRCm39) missense probably damaging 1.00
IGL02939:Xdh APN 17 74,250,840 (GRCm39) critical splice donor site probably null
IGL03327:Xdh APN 17 74,223,787 (GRCm39) missense probably benign
IGL03345:Xdh APN 17 74,213,027 (GRCm39) missense probably damaging 0.98
IGL03353:Xdh APN 17 74,202,781 (GRCm39) missense possibly damaging 0.65
inky UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
nucleus UTSW 17 74,206,007 (GRCm39) nonsense probably null
squidgame UTSW 17 74,246,831 (GRCm39) missense probably benign
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0033:Xdh UTSW 17 74,214,627 (GRCm39) missense probably benign 0.06
R0079:Xdh UTSW 17 74,198,213 (GRCm39) missense probably damaging 1.00
R0086:Xdh UTSW 17 74,191,433 (GRCm39) missense probably benign
R0319:Xdh UTSW 17 74,213,096 (GRCm39) splice site probably benign
R0336:Xdh UTSW 17 74,229,458 (GRCm39) missense possibly damaging 0.91
R0389:Xdh UTSW 17 74,205,357 (GRCm39) missense probably damaging 1.00
R0684:Xdh UTSW 17 74,250,886 (GRCm39) missense probably damaging 0.97
R0930:Xdh UTSW 17 74,230,077 (GRCm39) missense probably benign 0.00
R1073:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R1114:Xdh UTSW 17 74,248,144 (GRCm39) splice site probably benign
R1201:Xdh UTSW 17 74,225,413 (GRCm39) missense probably benign 0.05
R1230:Xdh UTSW 17 74,198,251 (GRCm39) missense probably damaging 1.00
R1351:Xdh UTSW 17 74,230,073 (GRCm39) missense probably benign 0.02
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1485:Xdh UTSW 17 74,221,014 (GRCm39) nonsense probably null
R1548:Xdh UTSW 17 74,220,896 (GRCm39) missense probably damaging 0.98
R1637:Xdh UTSW 17 74,207,573 (GRCm39) missense probably benign
R1641:Xdh UTSW 17 74,233,547 (GRCm39) missense probably benign
R1758:Xdh UTSW 17 74,217,204 (GRCm39) missense probably damaging 1.00
R1951:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R1969:Xdh UTSW 17 74,199,746 (GRCm39) missense possibly damaging 0.55
R2024:Xdh UTSW 17 74,228,300 (GRCm39) missense possibly damaging 0.92
R2080:Xdh UTSW 17 74,216,320 (GRCm39) missense probably damaging 1.00
R2157:Xdh UTSW 17 74,229,532 (GRCm39) missense probably damaging 1.00
R2300:Xdh UTSW 17 74,198,260 (GRCm39) missense probably damaging 1.00
R3783:Xdh UTSW 17 74,200,590 (GRCm39) splice site probably benign
R3796:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3797:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3798:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3799:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3819:Xdh UTSW 17 74,213,720 (GRCm39) missense probably benign 0.35
R4085:Xdh UTSW 17 74,223,874 (GRCm39) missense probably benign 0.35
R4240:Xdh UTSW 17 74,202,790 (GRCm39) missense possibly damaging 0.72
R4356:Xdh UTSW 17 74,222,685 (GRCm39) missense probably benign 0.01
R4522:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4523:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4524:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4600:Xdh UTSW 17 74,217,195 (GRCm39) missense probably benign 0.19
R4617:Xdh UTSW 17 74,225,389 (GRCm39) missense probably damaging 0.99
R4756:Xdh UTSW 17 74,193,381 (GRCm39) missense probably benign 0.24
R4761:Xdh UTSW 17 74,217,262 (GRCm39) missense possibly damaging 0.91
R4815:Xdh UTSW 17 74,213,210 (GRCm39) missense probably damaging 1.00
R4850:Xdh UTSW 17 74,205,330 (GRCm39) missense probably damaging 1.00
R4896:Xdh UTSW 17 74,217,238 (GRCm39) missense probably damaging 0.96
R4897:Xdh UTSW 17 74,207,703 (GRCm39) missense probably benign
R4923:Xdh UTSW 17 74,231,931 (GRCm39) missense possibly damaging 0.72
R4977:Xdh UTSW 17 74,205,965 (GRCm39) missense probably benign 0.05
R5030:Xdh UTSW 17 74,198,288 (GRCm39) missense probably damaging 1.00
R5347:Xdh UTSW 17 74,232,027 (GRCm39) missense probably benign
R5556:Xdh UTSW 17 74,204,759 (GRCm39) missense probably benign 0.21
R5566:Xdh UTSW 17 74,200,617 (GRCm39) missense probably damaging 1.00
R5568:Xdh UTSW 17 74,250,880 (GRCm39) missense possibly damaging 0.90
R5635:Xdh UTSW 17 74,220,870 (GRCm39) missense possibly damaging 0.92
R5662:Xdh UTSW 17 74,248,110 (GRCm39) missense probably damaging 0.99
R5955:Xdh UTSW 17 74,205,315 (GRCm39) missense probably damaging 1.00
R6058:Xdh UTSW 17 74,213,264 (GRCm39) missense probably damaging 1.00
R6061:Xdh UTSW 17 74,228,342 (GRCm39) missense probably damaging 1.00
R6412:Xdh UTSW 17 74,242,902 (GRCm39) missense probably benign 0.09
R6526:Xdh UTSW 17 74,207,546 (GRCm39) missense probably damaging 0.97
R6558:Xdh UTSW 17 74,200,708 (GRCm39) missense possibly damaging 0.95
R6843:Xdh UTSW 17 74,230,125 (GRCm39) missense probably damaging 1.00
R6932:Xdh UTSW 17 74,229,557 (GRCm39) missense probably damaging 0.99
R7028:Xdh UTSW 17 74,250,868 (GRCm39) missense probably damaging 0.99
R7418:Xdh UTSW 17 74,220,960 (GRCm39) missense possibly damaging 0.81
R7503:Xdh UTSW 17 74,233,205 (GRCm39) missense probably damaging 1.00
R7653:Xdh UTSW 17 74,204,040 (GRCm39) missense probably benign 0.10
R7763:Xdh UTSW 17 74,241,829 (GRCm39) missense possibly damaging 0.69
R7768:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R7904:Xdh UTSW 17 74,229,467 (GRCm39) missense probably benign 0.09
R8010:Xdh UTSW 17 74,216,312 (GRCm39) nonsense probably null
R8067:Xdh UTSW 17 74,207,652 (GRCm39) missense probably benign 0.01
R8238:Xdh UTSW 17 74,193,412 (GRCm39) missense probably benign
R8253:Xdh UTSW 17 74,225,377 (GRCm39) missense possibly damaging 0.94
R8346:Xdh UTSW 17 74,220,938 (GRCm39) missense probably damaging 1.00
R8350:Xdh UTSW 17 74,241,837 (GRCm39) missense probably damaging 1.00
R8381:Xdh UTSW 17 74,219,456 (GRCm39) missense probably benign
R8427:Xdh UTSW 17 74,242,926 (GRCm39) missense probably damaging 1.00
R8465:Xdh UTSW 17 74,206,007 (GRCm39) nonsense probably null
R8478:Xdh UTSW 17 74,213,053 (GRCm39) missense probably benign 0.00
R8680:Xdh UTSW 17 74,229,500 (GRCm39) missense probably benign
R8802:Xdh UTSW 17 74,225,405 (GRCm39) missense probably benign 0.00
R8984:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8985:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8995:Xdh UTSW 17 74,205,369 (GRCm39) missense probably damaging 1.00
R9035:Xdh UTSW 17 74,217,222 (GRCm39) missense probably benign
R9149:Xdh UTSW 17 74,222,688 (GRCm39) missense probably benign
R9181:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R9357:Xdh UTSW 17 74,233,541 (GRCm39) critical splice donor site probably null
R9357:Xdh UTSW 17 74,214,711 (GRCm39) missense probably damaging 0.97
R9609:Xdh UTSW 17 74,231,990 (GRCm39) missense possibly damaging 0.91
R9803:Xdh UTSW 17 74,229,455 (GRCm39) missense probably benign
X0019:Xdh UTSW 17 74,225,449 (GRCm39) missense probably damaging 1.00
Z1088:Xdh UTSW 17 74,193,423 (GRCm39) missense probably benign
Z1176:Xdh UTSW 17 74,230,037 (GRCm39) critical splice donor site probably null
Z1177:Xdh UTSW 17 74,204,690 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACTGAGATCATTGTGTTCC -3'
(R):5'- ATGTGCAGCTCTTCCTTCTGAG -3'

Sequencing Primer
(F):5'- ACTGAGATCATTGTGTTCCTCTTAG -3'
(R):5'- CCTTCTGAGTTCAGTTTTACACAAG -3'
Posted On 2016-07-06