Incidental Mutation 'R5185:Pcdhb16'
ID397846
Institutional Source Beutler Lab
Gene Symbol Pcdhb16
Ensembl Gene ENSMUSG00000047910
Gene Nameprotocadherin beta 16
SynonymsPcdhb8, PcdhbP
MMRRC Submission 042764-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R5185 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37477814-37483038 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37480089 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 701 (S701P)
Ref Sequence ENSEMBL: ENSMUSP00000056347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050034] [ENSMUST00000051442] [ENSMUST00000053856] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000050034
SMART Domains Protein: ENSMUSP00000059598
Gene: ENSMUSG00000047033

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 2.6e-33 PFAM
CA 155 240 7.79e-22 SMART
CA 264 345 4.37e-25 SMART
CA 368 449 4.4e-21 SMART
CA 473 559 7.38e-23 SMART
CA 589 670 4.48e-13 SMART
Pfam:Cadherin_C_2 686 770 5.3e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000051442
AA Change: S701P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000056347
Gene: ENSMUSG00000047910
AA Change: S701P

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 46 132 7.7e-1 SMART
CA 156 241 1.93e-17 SMART
CA 265 346 4.2e-27 SMART
CA 369 450 1.08e-24 SMART
CA 474 560 3.31e-25 SMART
CA 590 671 2.87e-11 SMART
Pfam:Cadherin_C_2 687 770 4.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053856
SMART Domains Protein: ENSMUSP00000055072
Gene: ENSMUSG00000046387

DomainStartEndE-ValueType
Pfam:Cadherin_2 31 112 5.8e-35 PFAM
CA 155 240 2.42e-18 SMART
CA 264 345 8.03e-24 SMART
CA 368 449 5.81e-21 SMART
CA 473 559 8.15e-25 SMART
CA 589 670 6.34e-13 SMART
Pfam:Cadherin_C_2 686 770 1.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.4149 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 95% (70/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf2 T C 11: 94,562,911 Y408C probably damaging Het
Aox4 T C 1: 58,254,318 L943S probably damaging Het
Ap1g1 G A 8: 109,863,326 probably benign Het
Arsb T C 13: 93,794,159 S212P probably damaging Het
Arsi A G 18: 60,916,912 N289S probably damaging Het
Atp6v1h T A 1: 5,095,642 F72I probably damaging Het
Atxn7 T C 14: 14,090,063 I336T probably benign Het
Bak1 G A 17: 27,022,748 P65L possibly damaging Het
Bcl6 A T 16: 23,972,947 M219K possibly damaging Het
Brd3 T C 2: 27,462,448 K157E probably damaging Het
Ccdc171 T G 4: 83,663,655 S674A possibly damaging Het
Cfap43 A G 19: 47,780,394 I737T probably benign Het
Cul9 A T 17: 46,525,832 V1089D possibly damaging Het
Dffa C A 4: 149,117,430 A155E probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Efcab12 T A 6: 115,823,490 M191L probably benign Het
Efl1 T C 7: 82,772,499 L1018P probably damaging Het
Fcho1 A G 8: 71,714,956 probably benign Het
Fndc3b T A 3: 27,457,070 T764S probably benign Het
Gm29125 T C 1: 80,384,231 noncoding transcript Het
Gm5108 A G 5: 67,944,610 probably benign Het
Gm9949 T G 18: 62,180,565 probably benign Het
Golgb1 T C 16: 36,875,141 probably benign Het
Gpd2 T C 2: 57,340,204 Y323H probably damaging Het
Grip1 T G 10: 119,931,259 D96E probably benign Het
Hmcn1 T C 1: 150,656,741 I3132V probably benign Het
Hsd17b1 T C 11: 101,080,198 W327R possibly damaging Het
Htra2 G A 6: 83,054,242 P62L probably benign Het
Kdr A T 5: 75,952,417 probably null Het
Kif14 T A 1: 136,527,469 C1626* probably null Het
Kmt2a A T 9: 44,820,246 probably benign Het
Krt15 T C 11: 100,133,433 T321A probably damaging Het
Lactbl1 A T 4: 136,631,045 H109L probably benign Het
Lilra6 T A 7: 3,914,636 H120L probably benign Het
Lpcat2 G A 8: 92,869,737 S134N probably benign Het
Mpp4 T C 1: 59,125,583 D465G probably benign Het
Naip2 A T 13: 100,189,351 D16E probably damaging Het
Nek5 C T 8: 22,083,381 A520T possibly damaging Het
Nfatc2 A G 2: 168,570,707 F132L possibly damaging Het
Nlrp3 C A 11: 59,565,084 T902N probably benign Het
Olfr1097 T C 2: 86,890,602 D191G probably benign Het
Olfr1230 A T 2: 89,296,387 H294Q probably benign Het
Olfr149 A T 9: 39,701,876 W298R probably benign Het
Olfr58 T C 9: 19,783,376 M81T probably damaging Het
Phf7 A G 14: 31,248,037 probably null Het
Plpp4 G A 7: 129,316,304 V68M probably damaging Het
Pnma2 A T 14: 66,916,129 M1L possibly damaging Het
Pnmal2 A T 7: 16,945,976 D295V probably damaging Het
Rad21l T C 2: 151,657,462 D270G probably benign Het
Ralgapa2 C A 2: 146,388,486 probably null Het
Rasal3 A T 17: 32,396,790 L334Q probably damaging Het
Rfx4 G T 10: 84,863,250 R240L probably damaging Het
Rnf19b T A 4: 129,083,920 C642* probably null Het
Slc28a2 G A 2: 122,458,194 E594K probably benign Het
Spata31 G T 13: 64,917,526 W15L possibly damaging Het
Spink5 T C 18: 44,015,644 S925P probably damaging Het
Svep1 C T 4: 58,084,534 G1865S probably damaging Het
Tg T C 15: 66,773,474 L791P probably damaging Het
Thbs4 A C 13: 92,775,167 V247G probably damaging Het
Tpcn2 A T 7: 145,255,454 F705Y probably damaging Het
Try10 A T 6: 41,356,549 H76L probably damaging Het
Ttn C T 2: 76,939,221 V2695I probably damaging Het
Tut1 C A 19: 8,955,450 T49N probably benign Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Xdh G A 17: 73,925,011 R235C probably damaging Het
Yipf4 A G 17: 74,492,475 D70G probably null Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Other mutations in Pcdhb16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Pcdhb16 APN 18 37478570 missense possibly damaging 0.95
IGL00540:Pcdhb16 APN 18 37479798 missense probably damaging 1.00
IGL01380:Pcdhb16 APN 18 37479445 missense probably benign 0.30
IGL02043:Pcdhb16 APN 18 37479195 missense probably benign 0.05
IGL02103:Pcdhb16 APN 18 37480108 missense probably benign 0.19
IGL02151:Pcdhb16 APN 18 37478358 missense possibly damaging 0.80
IGL02619:Pcdhb16 APN 18 37478217 nonsense probably null
IGL02832:Pcdhb16 APN 18 37478474 missense probably damaging 1.00
IGL03190:Pcdhb16 APN 18 37479343 missense probably damaging 1.00
IGL03274:Pcdhb16 APN 18 37479232 missense probably benign 0.04
IGL03292:Pcdhb16 APN 18 37480384 missense probably damaging 0.99
R0076:Pcdhb16 UTSW 18 37478359 missense probably damaging 1.00
R0423:Pcdhb16 UTSW 18 37480369 missense probably benign 0.00
R1191:Pcdhb16 UTSW 18 37479873 missense probably damaging 1.00
R1254:Pcdhb16 UTSW 18 37479295 missense possibly damaging 0.67
R1417:Pcdhb16 UTSW 18 37478127 missense probably benign 0.00
R1468:Pcdhb16 UTSW 18 37478089 missense probably damaging 1.00
R1468:Pcdhb16 UTSW 18 37478089 missense probably damaging 1.00
R1517:Pcdhb16 UTSW 18 37478098 missense probably benign 0.03
R1645:Pcdhb16 UTSW 18 37479370 missense probably benign 0.05
R1706:Pcdhb16 UTSW 18 37479652 missense probably benign 0.26
R1770:Pcdhb16 UTSW 18 37479180 missense probably damaging 1.00
R1809:Pcdhb16 UTSW 18 37478388 missense probably damaging 0.99
R1946:Pcdhb16 UTSW 18 37478899 nonsense probably null
R1967:Pcdhb16 UTSW 18 37479662 missense probably damaging 1.00
R2008:Pcdhb16 UTSW 18 37478263 missense probably damaging 1.00
R2220:Pcdhb16 UTSW 18 37478967 missense probably benign 0.16
R2432:Pcdhb16 UTSW 18 37479930 missense probably damaging 0.98
R3121:Pcdhb16 UTSW 18 37478218 missense possibly damaging 0.55
R3692:Pcdhb16 UTSW 18 37478287 missense probably benign 0.28
R3766:Pcdhb16 UTSW 18 37478196 nonsense probably null
R3891:Pcdhb16 UTSW 18 37479369 missense probably benign 0.19
R3892:Pcdhb16 UTSW 18 37479369 missense probably benign 0.19
R4551:Pcdhb16 UTSW 18 37479834 missense probably damaging 1.00
R4614:Pcdhb16 UTSW 18 37480345 missense probably benign 0.22
R4716:Pcdhb16 UTSW 18 37479405 missense probably benign 0.02
R4908:Pcdhb16 UTSW 18 37479841 unclassified probably null
R5225:Pcdhb16 UTSW 18 37479958 missense probably benign 0.02
R5422:Pcdhb16 UTSW 18 37479867 missense probably damaging 1.00
R5939:Pcdhb16 UTSW 18 37478064 missense probably benign
R6149:Pcdhb16 UTSW 18 37479155 missense possibly damaging 0.95
R6647:Pcdhb16 UTSW 18 37479172 missense possibly damaging 0.57
R7080:Pcdhb16 UTSW 18 37478463 nonsense probably null
R7354:Pcdhb16 UTSW 18 37478124 missense possibly damaging 0.79
R7413:Pcdhb16 UTSW 18 37478922 nonsense probably null
R7459:Pcdhb16 UTSW 18 37479553 missense probably benign 0.26
R7655:Pcdhb16 UTSW 18 37479405 missense probably benign 0.02
R7656:Pcdhb16 UTSW 18 37479405 missense probably benign 0.02
R7827:Pcdhb16 UTSW 18 37478851 missense possibly damaging 0.95
Z1176:Pcdhb16 UTSW 18 37479160
Predicted Primers PCR Primer
(F):5'- TACATACCTCCAGGCTGCTGAG -3'
(R):5'- CCAGTAAGACACACCTCATATTGG -3'

Sequencing Primer
(F):5'- CACAGGCTGATACTGCTAGTC -3'
(R):5'- CCTCATATTGGTAGCTCTGAGACAG -3'
Posted On2016-07-06