Incidental Mutation 'R5186:St18'
ID 397852
Institutional Source Beutler Lab
Gene Symbol St18
Ensembl Gene ENSMUSG00000033740
Gene Name suppression of tumorigenicity 18
Synonyms Nzf3, Myt3
MMRRC Submission 042765-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5186 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 6487231-6860940 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 6802317 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043578] [ENSMUST00000131494] [ENSMUST00000139838] [ENSMUST00000140079] [ENSMUST00000150761] [ENSMUST00000151281] [ENSMUST00000163727]
AlphaFold Q80TY4
Predicted Effect probably null
Transcript: ENSMUST00000043578
SMART Domains Protein: ENSMUSP00000042056
Gene: ENSMUSG00000033740

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 365 392 7.8e-15 PFAM
Pfam:zf-C2HC 409 437 4.2e-17 PFAM
Pfam:MYT1 476 713 1.3e-75 PFAM
Pfam:zf-C2HC 721 749 4e-19 PFAM
Pfam:zf-C2HC 765 793 1.7e-19 PFAM
Pfam:zf-C2HC 813 841 1.1e-17 PFAM
Pfam:zf-C2HC 866 893 9.1e-15 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000131494
SMART Domains Protein: ENSMUSP00000117789
Gene: ENSMUSG00000033740

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132207
Predicted Effect probably null
Transcript: ENSMUST00000139838
SMART Domains Protein: ENSMUSP00000118129
Gene: ENSMUSG00000033740

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000140079
SMART Domains Protein: ENSMUSP00000118322
Gene: ENSMUSG00000033740

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000150761
SMART Domains Protein: ENSMUSP00000120298
Gene: ENSMUSG00000033740

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000151281
SMART Domains Protein: ENSMUSP00000122055
Gene: ENSMUSG00000033740

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163727
SMART Domains Protein: ENSMUSP00000131417
Gene: ENSMUSG00000033740

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 365 392 7.8e-15 PFAM
Pfam:zf-C2HC 409 437 4.2e-17 PFAM
Pfam:MYT1 476 713 1.3e-75 PFAM
Pfam:zf-C2HC 721 749 4e-19 PFAM
Pfam:zf-C2HC 765 793 1.7e-19 PFAM
Pfam:zf-C2HC 813 841 1.1e-17 PFAM
Pfam:zf-C2HC 866 893 9.1e-15 PFAM
coiled coil region 918 987 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,743,739 L89H probably damaging Het
Abca8a T C 11: 110,091,599 I6V probably null Het
Aox1 A G 1: 58,068,370 D601G probably damaging Het
Asic1 GCACC GCACCACC 15: 99,698,803 probably benign Het
Cacna1g T G 11: 94,442,848 N931T probably damaging Het
Ccdc14 T C 16: 34,721,585 F511L probably damaging Het
Cd177 T A 7: 24,744,923 E710V probably benign Het
Cep112 T C 11: 108,752,560 C49R probably benign Het
Clip2 G A 5: 134,522,791 T159M possibly damaging Het
Dnah2 T C 11: 69,435,884 N3575S probably damaging Het
Dnah6 T A 6: 73,067,427 I3234F probably damaging Het
Eci3 G T 13: 34,946,978 A302E possibly damaging Het
Fam204a T C 19: 60,199,989 K214E probably damaging Het
Fam78a T C 2: 32,082,654 T85A possibly damaging Het
Flnb T C 14: 7,909,748 Y1401H probably damaging Het
Foxl2 A T 9: 98,956,055 D132V probably damaging Het
Frs2 C A 10: 117,078,842 W57C probably damaging Het
Gm26558 G T 2: 70,661,417 probably benign Het
Gpr139 A G 7: 119,144,840 V174A probably benign Het
Grik5 T C 7: 25,015,819 T676A probably damaging Het
H60c T C 10: 3,259,273 probably null Het
Hspa1l A G 17: 34,978,469 K495E probably damaging Het
Irgm1 C T 11: 48,866,217 V256I probably benign Het
Kat7 T A 11: 95,286,416 T293S probably benign Het
Lipg C T 18: 74,960,938 V13I probably benign Het
Lrrn1 A T 6: 107,569,224 Y661F probably damaging Het
Mllt3 A G 4: 87,840,995 V272A probably benign Het
Mx1 G A 16: 97,455,494 R162C probably benign Het
Myo18b T A 5: 112,871,470 D647V probably damaging Het
Naf1 G A 8: 66,879,646 V329I probably benign Het
Olfr1286 A T 2: 111,420,774 M59K probably damaging Het
Olfr654 A T 7: 104,588,211 I153F probably damaging Het
Olfr936 A T 9: 39,046,969 C194* probably null Het
P2rx5 G A 11: 73,171,790 V442M possibly damaging Het
Pcdhb9 A G 18: 37,401,232 E93G probably damaging Het
Pcdhga4 A T 18: 37,687,426 N676I probably benign Het
Pgm5 A G 19: 24,820,128 M230T probably damaging Het
Pik3c2g T C 6: 139,622,018 V44A probably damaging Het
Pp2d1 T C 17: 53,508,140 M519V probably benign Het
Ppp1r10 A G 17: 35,928,511 E404G probably damaging Het
Prpf8 A T 11: 75,489,783 E104V possibly damaging Het
Ptpa T C 2: 30,438,355 probably null Het
Pygl A C 12: 70,201,344 N248K probably damaging Het
Rbm8a A G 3: 96,630,932 D102G probably damaging Het
Sema3d A G 5: 12,584,908 D647G probably benign Het
Serpinb11 A T 1: 107,379,754 D305V probably damaging Het
Slc12a8 T C 16: 33,617,208 I337T probably damaging Het
Slc29a2 G A 19: 5,028,967 R286Q probably benign Het
Slc2a3 T A 6: 122,735,583 D234V probably damaging Het
Slco4a1 T C 2: 180,473,108 V608A probably damaging Het
Srrm2 C T 17: 23,816,587 T831I probably benign Het
Tesk2 G C 4: 116,741,896 G67A probably damaging Het
Tlr1 A T 5: 64,925,221 L671H probably damaging Het
Tmem63b A T 17: 45,661,477 Y735N possibly damaging Het
Tmprss11a C T 5: 86,420,079 C263Y probably damaging Het
Trio A T 15: 27,897,991 V345E probably damaging Het
Ubr5 A G 15: 37,997,916 S1674P probably damaging Het
Uchl3 T A 14: 101,695,917 C209S probably damaging Het
Uhmk1 T C 1: 170,211,167 N206S probably damaging Het
Uhrf1 C T 17: 56,318,340 R588W probably damaging Het
Usp28 T C 9: 49,010,250 V256A probably damaging Het
Utrn C A 10: 12,728,777 L552F probably damaging Het
Vmn1r55 A T 7: 5,146,986 M146K probably damaging Het
Vmn1r57 A C 7: 5,221,108 I211L probably benign Het
Zar1 C T 5: 72,577,399 C316Y probably damaging Het
Zc3h11a A T 1: 133,621,674 S750T probably damaging Het
Zcchc6 A G 13: 59,816,656 probably null Het
Zfp366 G A 13: 99,246,168 C613Y probably benign Het
Zfp37 A T 4: 62,191,256 C524S probably damaging Het
Zfp516 T C 18: 82,957,093 V472A probably benign Het
Zhx1 A T 15: 58,052,423 M809K probably damaging Het
Zic1 T C 9: 91,364,371 Y216C probably damaging Het
Other mutations in St18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:St18 APN 1 6802572 missense probably benign 0.07
IGL00840:St18 APN 1 6833594 missense probably damaging 1.00
IGL01016:St18 APN 1 6844323 missense probably damaging 0.98
IGL01116:St18 APN 1 6802632 missense probably damaging 0.96
IGL01719:St18 APN 1 6845796 splice site probably benign
IGL01885:St18 APN 1 6844372 critical splice donor site probably null
IGL02486:St18 APN 1 6820083 missense probably damaging 1.00
IGL02611:St18 APN 1 6768890 splice site probably benign
IGL02742:St18 APN 1 6802316 splice site probably benign
IGL02953:St18 APN 1 6844113 splice site probably benign
IGL02999:St18 APN 1 6817605 missense probably benign 0.01
IGL03092:St18 APN 1 6768894 splice site probably benign
Smallish UTSW 1 6855473 critical splice donor site probably null
IGL03055:St18 UTSW 1 6802735 missense probably damaging 0.99
R0089:St18 UTSW 1 6848948 missense probably benign 0.02
R0257:St18 UTSW 1 6819962 missense probably benign 0.04
R0383:St18 UTSW 1 6803024 missense probably damaging 1.00
R0588:St18 UTSW 1 6817738 missense probably damaging 0.99
R0989:St18 UTSW 1 6827881 missense probably benign 0.04
R1068:St18 UTSW 1 6795562 missense probably benign 0.01
R1311:St18 UTSW 1 6845644 missense probably damaging 1.00
R1530:St18 UTSW 1 6845569 critical splice acceptor site probably null
R1723:St18 UTSW 1 6810685 splice site probably benign
R1926:St18 UTSW 1 6802689 missense probably benign 0.00
R1927:St18 UTSW 1 6802712 missense probably benign 0.00
R2035:St18 UTSW 1 6802328 missense probably benign 0.00
R2091:St18 UTSW 1 6827971 missense probably benign 0.08
R2139:St18 UTSW 1 6810615 missense possibly damaging 0.85
R2261:St18 UTSW 1 6845572 missense probably damaging 0.96
R2300:St18 UTSW 1 6855402 missense probably damaging 1.00
R2322:St18 UTSW 1 6844124 nonsense probably null
R2846:St18 UTSW 1 6845587 missense probably damaging 0.96
R3738:St18 UTSW 1 6855473 critical splice donor site probably null
R3739:St18 UTSW 1 6855473 critical splice donor site probably null
R3772:St18 UTSW 1 6844329 missense probably damaging 1.00
R3805:St18 UTSW 1 6802353 missense probably damaging 1.00
R3953:St18 UTSW 1 6802893 missense probably damaging 0.99
R4034:St18 UTSW 1 6855473 critical splice donor site probably null
R4036:St18 UTSW 1 6827786 missense probably damaging 1.00
R4407:St18 UTSW 1 6827837 missense probably benign 0.29
R4527:St18 UTSW 1 6855423 missense probably damaging 1.00
R4740:St18 UTSW 1 6817604 missense probably benign
R4838:St18 UTSW 1 6802905 missense probably benign 0.01
R5182:St18 UTSW 1 6817653 missense probably benign 0.03
R5354:St18 UTSW 1 6844171 missense probably damaging 1.00
R5423:St18 UTSW 1 6802616 missense possibly damaging 0.91
R5724:St18 UTSW 1 6770950 missense probably benign 0.13
R6182:St18 UTSW 1 6844118 splice site probably null
R6491:St18 UTSW 1 6827985 nonsense probably null
R6503:St18 UTSW 1 6795397 missense probably damaging 1.00
R7037:St18 UTSW 1 6803036 missense possibly damaging 0.65
R7098:St18 UTSW 1 6827842 missense probably damaging 1.00
R7132:St18 UTSW 1 6859127 missense
R7144:St18 UTSW 1 6833594 missense probably damaging 1.00
R7150:St18 UTSW 1 6803019 missense probably damaging 1.00
R7334:St18 UTSW 1 6802559 missense probably benign 0.00
R7502:St18 UTSW 1 6827970 missense probably benign 0.09
R7729:St18 UTSW 1 6802537 missense probably benign 0.00
R7848:St18 UTSW 1 6857445 critical splice donor site probably null
R8088:St18 UTSW 1 6828005 missense probably benign 0.00
R8299:St18 UTSW 1 6802992 missense probably benign 0.01
R8338:St18 UTSW 1 6809292 missense probably damaging 1.00
R8690:St18 UTSW 1 6802564 missense probably benign
R8753:St18 UTSW 1 6845791 missense probably damaging 1.00
R8808:St18 UTSW 1 6810602 missense probably damaging 1.00
R8880:St18 UTSW 1 6795395 nonsense probably null
R9055:St18 UTSW 1 6802982 nonsense probably null
R9292:St18 UTSW 1 6827882 missense probably benign 0.32
R9322:St18 UTSW 1 6795523 missense probably benign 0.00
R9530:St18 UTSW 1 6802773 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCATGTACTTACATATGCAGGC -3'
(R):5'- TCTCACATGTGGTCTGCAC -3'

Sequencing Primer
(F):5'- GTACTTACATATGCAGGCATGTG -3'
(R):5'- GCACAGACTCACTTTCCTCAAATTTG -3'
Posted On 2016-07-06