Incidental Mutation 'R5186:Uhmk1'
ID 397858
Institutional Source Beutler Lab
Gene Symbol Uhmk1
Ensembl Gene ENSMUSG00000026667
Gene Name U2AF homology motif (UHM) kinase 1
Synonyms C820018A03Rik, Kist, OTTMUSG00000021542, KIS
MMRRC Submission 042765-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.917) question?
Stock # R5186 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 170193420-170215397 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 170211167 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 206 (N206S)
Ref Sequence ENSEMBL: ENSMUSP00000120787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027979] [ENSMUST00000123399] [ENSMUST00000150821]
AlphaFold P97343
Predicted Effect probably damaging
Transcript: ENSMUST00000027979
AA Change: N206S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027979
Gene: ENSMUSG00000026667
AA Change: N206S

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 23 298 4.1e-22 PFAM
Pfam:Pkinase 23 304 1.3e-40 PFAM
Pfam:Kdo 65 187 2.6e-7 PFAM
RRM 320 402 2.47e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123399
AA Change: N206S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120787
Gene: ENSMUSG00000026667
AA Change: N206S

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 23 299 1.8e-22 PFAM
Pfam:Pkinase 23 304 4.6e-43 PFAM
low complexity region 325 341 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000150821
AA Change: N117S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115622
Gene: ENSMUSG00000026667
AA Change: N117S

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 210 7e-16 PFAM
Pfam:Pkinase 2 215 1.2e-34 PFAM
RRM 231 313 2.47e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159201
SMART Domains Protein: ENSMUSP00000125148
Gene: ENSMUSG00000044306

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
low complexity region 96 108 N/A INTRINSIC
low complexity region 114 132 N/A INTRINSIC
low complexity region 145 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194988
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a serine/threonine protein kinase that promotes cell cycle progression through G1 by phosphorylation of the cyclin-dependent kinase inhibitor 1B (p27Kip1), which causes nuclear export and degradation. The encoded protein is also thought to function in the adult nervous system and the gene has been associated with schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
PHENOTYPE: Mice with disruptions in this gene show accelerated development of neointima after arterial injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,743,739 L89H probably damaging Het
Abca8a T C 11: 110,091,599 I6V probably null Het
Aox1 A G 1: 58,068,370 D601G probably damaging Het
Asic1 GCACC GCACCACC 15: 99,698,803 probably benign Het
Cacna1g T G 11: 94,442,848 N931T probably damaging Het
Ccdc14 T C 16: 34,721,585 F511L probably damaging Het
Cd177 T A 7: 24,744,923 E710V probably benign Het
Cep112 T C 11: 108,752,560 C49R probably benign Het
Clip2 G A 5: 134,522,791 T159M possibly damaging Het
Dnah2 T C 11: 69,435,884 N3575S probably damaging Het
Dnah6 T A 6: 73,067,427 I3234F probably damaging Het
Eci3 G T 13: 34,946,978 A302E possibly damaging Het
Fam204a T C 19: 60,199,989 K214E probably damaging Het
Fam78a T C 2: 32,082,654 T85A possibly damaging Het
Flnb T C 14: 7,909,748 Y1401H probably damaging Het
Foxl2 A T 9: 98,956,055 D132V probably damaging Het
Frs2 C A 10: 117,078,842 W57C probably damaging Het
Gm26558 G T 2: 70,661,417 probably benign Het
Gpr139 A G 7: 119,144,840 V174A probably benign Het
Grik5 T C 7: 25,015,819 T676A probably damaging Het
H60c T C 10: 3,259,273 probably null Het
Hspa1l A G 17: 34,978,469 K495E probably damaging Het
Irgm1 C T 11: 48,866,217 V256I probably benign Het
Kat7 T A 11: 95,286,416 T293S probably benign Het
Lipg C T 18: 74,960,938 V13I probably benign Het
Lrrn1 A T 6: 107,569,224 Y661F probably damaging Het
Mllt3 A G 4: 87,840,995 V272A probably benign Het
Mx1 G A 16: 97,455,494 R162C probably benign Het
Myo18b T A 5: 112,871,470 D647V probably damaging Het
Naf1 G A 8: 66,879,646 V329I probably benign Het
Olfr1286 A T 2: 111,420,774 M59K probably damaging Het
Olfr654 A T 7: 104,588,211 I153F probably damaging Het
Olfr936 A T 9: 39,046,969 C194* probably null Het
P2rx5 G A 11: 73,171,790 V442M possibly damaging Het
Pcdhb9 A G 18: 37,401,232 E93G probably damaging Het
Pcdhga4 A T 18: 37,687,426 N676I probably benign Het
Pgm5 A G 19: 24,820,128 M230T probably damaging Het
Pik3c2g T C 6: 139,622,018 V44A probably damaging Het
Pp2d1 T C 17: 53,508,140 M519V probably benign Het
Ppp1r10 A G 17: 35,928,511 E404G probably damaging Het
Prpf8 A T 11: 75,489,783 E104V possibly damaging Het
Ptpa T C 2: 30,438,355 probably null Het
Pygl A C 12: 70,201,344 N248K probably damaging Het
Rbm8a A G 3: 96,630,932 D102G probably damaging Het
Sema3d A G 5: 12,584,908 D647G probably benign Het
Serpinb11 A T 1: 107,379,754 D305V probably damaging Het
Slc12a8 T C 16: 33,617,208 I337T probably damaging Het
Slc29a2 G A 19: 5,028,967 R286Q probably benign Het
Slc2a3 T A 6: 122,735,583 D234V probably damaging Het
Slco4a1 T C 2: 180,473,108 V608A probably damaging Het
Srrm2 C T 17: 23,816,587 T831I probably benign Het
St18 T A 1: 6,802,317 probably null Het
Tesk2 G C 4: 116,741,896 G67A probably damaging Het
Tlr1 A T 5: 64,925,221 L671H probably damaging Het
Tmem63b A T 17: 45,661,477 Y735N possibly damaging Het
Tmprss11a C T 5: 86,420,079 C263Y probably damaging Het
Trio A T 15: 27,897,991 V345E probably damaging Het
Ubr5 A G 15: 37,997,916 S1674P probably damaging Het
Uchl3 T A 14: 101,695,917 C209S probably damaging Het
Uhrf1 C T 17: 56,318,340 R588W probably damaging Het
Usp28 T C 9: 49,010,250 V256A probably damaging Het
Utrn C A 10: 12,728,777 L552F probably damaging Het
Vmn1r55 A T 7: 5,146,986 M146K probably damaging Het
Vmn1r57 A C 7: 5,221,108 I211L probably benign Het
Zar1 C T 5: 72,577,399 C316Y probably damaging Het
Zc3h11a A T 1: 133,621,674 S750T probably damaging Het
Zcchc6 A G 13: 59,816,656 probably null Het
Zfp366 G A 13: 99,246,168 C613Y probably benign Het
Zfp37 A T 4: 62,191,256 C524S probably damaging Het
Zfp516 T C 18: 82,957,093 V472A probably benign Het
Zhx1 A T 15: 58,052,423 M809K probably damaging Het
Zic1 T C 9: 91,364,371 Y216C probably damaging Het
Other mutations in Uhmk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Uhmk1 APN 1 170207113 critical splice donor site probably null
IGL02451:Uhmk1 APN 1 170212526 missense possibly damaging 0.89
R0452:Uhmk1 UTSW 1 170212402 missense possibly damaging 0.92
R0507:Uhmk1 UTSW 1 170207191 missense probably damaging 1.00
R1466:Uhmk1 UTSW 1 170208653 critical splice donor site probably null
R1466:Uhmk1 UTSW 1 170208653 critical splice donor site probably null
R1584:Uhmk1 UTSW 1 170208653 critical splice donor site probably null
R1676:Uhmk1 UTSW 1 170200012 missense probably damaging 1.00
R1806:Uhmk1 UTSW 1 170211059 missense probably damaging 0.98
R2039:Uhmk1 UTSW 1 170212267 missense probably damaging 1.00
R4567:Uhmk1 UTSW 1 170205117 nonsense probably null
R4658:Uhmk1 UTSW 1 170207205 missense probably damaging 1.00
R4765:Uhmk1 UTSW 1 170199901 missense probably damaging 1.00
R5686:Uhmk1 UTSW 1 170211218 missense probably damaging 1.00
R6210:Uhmk1 UTSW 1 170212237 missense probably damaging 1.00
R6238:Uhmk1 UTSW 1 170199994 missense probably damaging 0.99
R6253:Uhmk1 UTSW 1 170199880 missense probably damaging 1.00
R6682:Uhmk1 UTSW 1 170212235 critical splice donor site probably null
R7522:Uhmk1 UTSW 1 170215240 start codon destroyed probably benign 0.00
R7582:Uhmk1 UTSW 1 170200001 missense probably damaging 1.00
R7916:Uhmk1 UTSW 1 170205188 missense possibly damaging 0.46
R9097:Uhmk1 UTSW 1 170215310 unclassified probably benign
R9483:Uhmk1 UTSW 1 170207344 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACTGATTAAAAGCTGCAAAGCC -3'
(R):5'- CAGTGACCTTCTGTACCACTG -3'

Sequencing Primer
(F):5'- TGATTAAAAGCTGCAAAGCCAAACTG -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'
Posted On 2016-07-06