Mutagenetix > Incidental Mutation

Incidental Mutation 'R5186:Tesk2'

397868

Institutional Source

Beutler Lab

Gene Symbol

Tesk2

Ensembl Gene

ENSMUSG00000033985

Gene Name

testis-specific kinase 2

Synonyms

MMRRC Submission

042765-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.126) question?

Stock #

R5186 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

116720948-116805956 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 116741896 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Alanine at position 67 (G67A)

Ref Sequence

ENSEMBL: ENSMUSP00000102067 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045542] [ENSMUST00000106456] [ENSMUST00000106459]

AlphaFold

Q8VCT9

Predicted Effect

probably damaging
Transcript: ENSMUST00000045542
AA Change: G67A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000041009
Gene: ENSMUSG00000033985
AA Change: G67A

Domain	Start	End	E-Value	Type
low complexity region	24	30	N/A	INTRINSIC
Pfam:Pkinase	59	309	1.6e-48	PFAM
Pfam:Pkinase_Tyr	59	309	1.2e-50	PFAM
low complexity region	539	546	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000106456
AA Change: G67A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000102064
Gene: ENSMUSG00000033985
AA Change: G67A

Domain	Start	End	E-Value	Type
low complexity region	24	30	N/A	INTRINSIC
Pfam:Pkinase_Tyr	59	291	4.5e-46	PFAM
Pfam:Pkinase	60	332	3.6e-46	PFAM
low complexity region	510	517	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000106459
AA Change: G67A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102067
Gene: ENSMUSG00000033985
AA Change: G67A

Domain	Start	End	E-Value	Type
low complexity region	24	30	N/A	INTRINSIC
Pfam:Pkinase_Tyr	59	238	6.1e-37	PFAM
Pfam:Pkinase	60	239	4.3e-39	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124628

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134192

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a serine/threonine protein kinase that contains an N-terminal protein kinase domain that is structurally similar to the kinase domains of testis-specific protein kinase-1 and the LIM motif-containing protein kinases (LIMKs). Its overall structure is most related to the former, indicating that it belongs to the TESK subgroup of the LIMK/TESK family of protein kinases. This gene is predominantly expressed in testis and prostate. The developmental expression pattern of the rat gene in testis suggests an important role for this gene in meitoic stages and/or early stages of spermiogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	T	13: 59,743,739	L89H	probably damaging	Het
Abca8a	T	C	11: 110,091,599	I6V	probably null	Het
Aox1	A	G	1: 58,068,370	D601G	probably damaging	Het
Asic1	GCACC	GCACCACC	15: 99,698,803		probably benign	Het
Cacna1g	T	G	11: 94,442,848	N931T	probably damaging	Het
Ccdc14	T	C	16: 34,721,585	F511L	probably damaging	Het
Cd177	T	A	7: 24,744,923	E710V	probably benign	Het
Cep112	T	C	11: 108,752,560	C49R	probably benign	Het
Clip2	G	A	5: 134,522,791	T159M	possibly damaging	Het
Dnah2	T	C	11: 69,435,884	N3575S	probably damaging	Het
Dnah6	T	A	6: 73,067,427	I3234F	probably damaging	Het
Eci3	G	T	13: 34,946,978	A302E	possibly damaging	Het
Fam204a	T	C	19: 60,199,989	K214E	probably damaging	Het
Fam78a	T	C	2: 32,082,654	T85A	possibly damaging	Het
Flnb	T	C	14: 7,909,748	Y1401H	probably damaging	Het
Foxl2	A	T	9: 98,956,055	D132V	probably damaging	Het
Frs2	C	A	10: 117,078,842	W57C	probably damaging	Het
Gm26558	G	T	2: 70,661,417		probably benign	Het
Gpr139	A	G	7: 119,144,840	V174A	probably benign	Het
Grik5	T	C	7: 25,015,819	T676A	probably damaging	Het
H60c	T	C	10: 3,259,273		probably null	Het
Hspa1l	A	G	17: 34,978,469	K495E	probably damaging	Het
Irgm1	C	T	11: 48,866,217	V256I	probably benign	Het
Kat7	T	A	11: 95,286,416	T293S	probably benign	Het
Lipg	C	T	18: 74,960,938	V13I	probably benign	Het
Lrrn1	A	T	6: 107,569,224	Y661F	probably damaging	Het
Mllt3	A	G	4: 87,840,995	V272A	probably benign	Het
Mx1	G	A	16: 97,455,494	R162C	probably benign	Het
Myo18b	T	A	5: 112,871,470	D647V	probably damaging	Het
Naf1	G	A	8: 66,879,646	V329I	probably benign	Het
Olfr1286	A	T	2: 111,420,774	M59K	probably damaging	Het
Olfr654	A	T	7: 104,588,211	I153F	probably damaging	Het
Olfr936	A	T	9: 39,046,969	C194*	probably null	Het
P2rx5	G	A	11: 73,171,790	V442M	possibly damaging	Het
Pcdhb9	A	G	18: 37,401,232	E93G	probably damaging	Het
Pcdhga4	A	T	18: 37,687,426	N676I	probably benign	Het
Pgm5	A	G	19: 24,820,128	M230T	probably damaging	Het
Pik3c2g	T	C	6: 139,622,018	V44A	probably damaging	Het
Pp2d1	T	C	17: 53,508,140	M519V	probably benign	Het
Ppp1r10	A	G	17: 35,928,511	E404G	probably damaging	Het
Prpf8	A	T	11: 75,489,783	E104V	possibly damaging	Het
Ptpa	T	C	2: 30,438,355		probably null	Het
Pygl	A	C	12: 70,201,344	N248K	probably damaging	Het
Rbm8a	A	G	3: 96,630,932	D102G	probably damaging	Het
Sema3d	A	G	5: 12,584,908	D647G	probably benign	Het
Serpinb11	A	T	1: 107,379,754	D305V	probably damaging	Het
Slc12a8	T	C	16: 33,617,208	I337T	probably damaging	Het
Slc29a2	G	A	19: 5,028,967	R286Q	probably benign	Het
Slc2a3	T	A	6: 122,735,583	D234V	probably damaging	Het
Slco4a1	T	C	2: 180,473,108	V608A	probably damaging	Het
Srrm2	C	T	17: 23,816,587	T831I	probably benign	Het
St18	T	A	1: 6,802,317		probably null	Het
Tlr1	A	T	5: 64,925,221	L671H	probably damaging	Het
Tmem63b	A	T	17: 45,661,477	Y735N	possibly damaging	Het
Tmprss11a	C	T	5: 86,420,079	C263Y	probably damaging	Het
Trio	A	T	15: 27,897,991	V345E	probably damaging	Het
Ubr5	A	G	15: 37,997,916	S1674P	probably damaging	Het
Uchl3	T	A	14: 101,695,917	C209S	probably damaging	Het
Uhmk1	T	C	1: 170,211,167	N206S	probably damaging	Het
Uhrf1	C	T	17: 56,318,340	R588W	probably damaging	Het
Usp28	T	C	9: 49,010,250	V256A	probably damaging	Het
Utrn	C	A	10: 12,728,777	L552F	probably damaging	Het
Vmn1r55	A	T	7: 5,146,986	M146K	probably damaging	Het
Vmn1r57	A	C	7: 5,221,108	I211L	probably benign	Het
Zar1	C	T	5: 72,577,399	C316Y	probably damaging	Het
Zc3h11a	A	T	1: 133,621,674	S750T	probably damaging	Het
Zcchc6	A	G	13: 59,816,656		probably null	Het
Zfp366	G	A	13: 99,246,168	C613Y	probably benign	Het
Zfp37	A	T	4: 62,191,256	C524S	probably damaging	Het
Zfp516	T	C	18: 82,957,093	V472A	probably benign	Het
Zhx1	A	T	15: 58,052,423	M809K	probably damaging	Het
Zic1	T	C	9: 91,364,371	Y216C	probably damaging	Het

Other mutations in Tesk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01625:Tesk2	APN	4	116771801	missense	possibly damaging	0.68
IGL02051:Tesk2	APN	4	116751184	missense	probably damaging	1.00
IGL02223:Tesk2	APN	4	116741825	nonsense	probably null
IGL02747:Tesk2	APN	4	116802879	missense	probably benign	0.31
IGL02942:Tesk2	APN	4	116771820	missense	probably damaging	0.99
BB006:Tesk2	UTSW	4	116802255	missense	probably benign	0.08
BB016:Tesk2	UTSW	4	116802255	missense	probably benign	0.08
R1804:Tesk2	UTSW	4	116800621	unclassified	probably benign
R1936:Tesk2	UTSW	4	116741824	missense	probably benign	0.23
R1986:Tesk2	UTSW	4	116751193	missense	probably damaging	1.00
R2414:Tesk2	UTSW	4	116801757	missense	possibly damaging	0.96
R4632:Tesk2	UTSW	4	116741712	missense	probably benign	0.01
R4896:Tesk2	UTSW	4	116802993	missense	probably benign
R5209:Tesk2	UTSW	4	116724698	start gained	probably benign
R5278:Tesk2	UTSW	4	116805936	intron	probably benign
R5769:Tesk2	UTSW	4	116802315	splice site	probably null
R6199:Tesk2	UTSW	4	116792170	missense	probably damaging	0.98
R6464:Tesk2	UTSW	4	116802849	missense	probably damaging	1.00
R6567:Tesk2	UTSW	4	116792164	missense	probably damaging	1.00
R6867:Tesk2	UTSW	4	116801798	missense	probably damaging	0.99
R7028:Tesk2	UTSW	4	116802687	nonsense	probably null
R7929:Tesk2	UTSW	4	116802255	missense	probably benign	0.08
R8830:Tesk2	UTSW	4	116802287	missense	probably benign	0.00
R8957:Tesk2	UTSW	4	116802713	missense	probably benign	0.10
R9043:Tesk2	UTSW	4	116802951	missense	probably benign	0.20
R9074:Tesk2	UTSW	4	116801736	missense	probably damaging	1.00
R9464:Tesk2	UTSW	4	116801246	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACTCAATTGCAGGGTTTCCC -3'
(R):5'- TCTGGCAGTTCACAGCTTAC -3'

Sequencing Primer
(F):5'- GGTTTCCCCCACGTGTG -3'
(R):5'- TGTAATCCCAACTCTCGGGAAGTG -3'

Posted On

2016-07-06