Mutagenetix > Incidental Mutations

Incidental Mutation 'R5186:Cd177'

397883

Institutional Source

Beutler Lab

Gene Symbol

Cd177

Ensembl Gene

ENSMUSG00000052212

Gene Name

CD177 antigen

Synonyms

Pdp3, 1190003K14Rik

MMRRC Submission

042765-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.552) question?

Stock #

R5186 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

24743983-24760311 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 24744923 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 710 (E710V)

Ref Sequence

ENSEMBL: ENSMUSP00000064934 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063956]

Predicted Effect

probably benign
Transcript: ENSMUST00000063956
AA Change: E710V

PolyPhen 2 Score 0.305 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000064934
Gene: ENSMUSG00000052212
AA Change: E710V

Domain	Start	End	E-Value	Type
Pfam:UPAR_LY6	134	214	3.7e-11	PFAM
Pfam:UPAR_LY6	226	300	1.2e-4	PFAM
low complexity region	301	317	N/A	INTRINSIC
Pfam:UPAR_LY6	322	400	1.5e-9	PFAM
Pfam:UPAR_LY6	511	586	9.1e-12	PFAM
Pfam:UPAR_LY6	705	782	1.4e-11	PFAM
low complexity region	795	811	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206160

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyl-phosphatidylinositol (GPI)-linked cell surface glycoprotein that plays a role in neutrophil activation. The protein can bind platelet endothelial cell adhesion molecule-1 and function in neutrophil transmigration. Mutations in this gene are associated with myeloproliferative diseases. Over-expression of this gene has been found in patients with polycythemia rubra vera. Autoantibodies against the protein may result in pulmonary transfusion reactions, and it may be involved in Wegener's granulomatosis. A related pseudogene, which is adjacent to this gene on chromosome 19, has been identified. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased circulating neutrophils, increased neutrophil cell death and decreased neutrophils and monocytes early after S. aureus infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	T	13: 59,743,739	L89H	probably damaging	Het
Abca8a	T	C	11: 110,091,599	I6V	probably null	Het
Aox1	A	G	1: 58,068,370	D601G	probably damaging	Het
Asic1	GCACC	GCACCACC	15: 99,698,803		probably benign	Het
Cacna1g	T	G	11: 94,442,848	N931T	probably damaging	Het
Ccdc14	T	C	16: 34,721,585	F511L	probably damaging	Het
Cep112	T	C	11: 108,752,560	C49R	probably benign	Het
Clip2	G	A	5: 134,522,791	T159M	possibly damaging	Het
Dnah2	T	C	11: 69,435,884	N3575S	probably damaging	Het
Dnah6	T	A	6: 73,067,427	I3234F	probably damaging	Het
Eci3	G	T	13: 34,946,978	A302E	possibly damaging	Het
Fam204a	T	C	19: 60,199,989	K214E	probably damaging	Het
Fam78a	T	C	2: 32,082,654	T85A	possibly damaging	Het
Flnb	T	C	14: 7,909,748	Y1401H	probably damaging	Het
Foxl2	A	T	9: 98,956,055	D132V	probably damaging	Het
Frs2	C	A	10: 117,078,842	W57C	probably damaging	Het
Gm26558	G	T	2: 70,661,417		probably benign	Het
Gpr139	A	G	7: 119,144,840	V174A	probably benign	Het
Grik5	T	C	7: 25,015,819	T676A	probably damaging	Het
H60c	T	C	10: 3,259,273		probably null	Het
Hspa1l	A	G	17: 34,978,469	K495E	probably damaging	Het
Irgm1	C	T	11: 48,866,217	V256I	probably benign	Het
Kat7	T	A	11: 95,286,416	T293S	probably benign	Het
Lipg	C	T	18: 74,960,938	V13I	probably benign	Het
Lrrn1	A	T	6: 107,569,224	Y661F	probably damaging	Het
Mllt3	A	G	4: 87,840,995	V272A	probably benign	Het
Mx1	G	A	16: 97,455,494	R162C	probably benign	Het
Myo18b	T	A	5: 112,871,470	D647V	probably damaging	Het
Naf1	G	A	8: 66,879,646	V329I	probably benign	Het
Olfr1286	A	T	2: 111,420,774	M59K	probably damaging	Het
Olfr654	A	T	7: 104,588,211	I153F	probably damaging	Het
Olfr936	A	T	9: 39,046,969	C194*	probably null	Het
P2rx5	G	A	11: 73,171,790	V442M	possibly damaging	Het
Pcdhb9	A	G	18: 37,401,232	E93G	probably damaging	Het
Pcdhga4	A	T	18: 37,687,426	N676I	probably benign	Het
Pgm5	A	G	19: 24,820,128	M230T	probably damaging	Het
Pik3c2g	T	C	6: 139,622,018	V44A	probably damaging	Het
Pp2d1	T	C	17: 53,508,140	M519V	probably benign	Het
Ppp1r10	A	G	17: 35,928,511	E404G	probably damaging	Het
Prpf8	A	T	11: 75,489,783	E104V	possibly damaging	Het
Ptpa	T	C	2: 30,438,355		probably null	Het
Pygl	A	C	12: 70,201,344	N248K	probably damaging	Het
Rbm8a	A	G	3: 96,630,932	D102G	probably damaging	Het
Sema3d	A	G	5: 12,584,908	D647G	probably benign	Het
Serpinb11	A	T	1: 107,379,754	D305V	probably damaging	Het
Slc12a8	T	C	16: 33,617,208	I337T	probably damaging	Het
Slc29a2	G	A	19: 5,028,967	R286Q	probably benign	Het
Slc2a3	T	A	6: 122,735,583	D234V	probably damaging	Het
Slco4a1	T	C	2: 180,473,108	V608A	probably damaging	Het
Srrm2	C	T	17: 23,816,587	T831I	probably benign	Het
St18	T	A	1: 6,802,317		probably null	Het
Tesk2	G	C	4: 116,741,896	G67A	probably damaging	Het
Tlr1	A	T	5: 64,925,221	L671H	probably damaging	Het
Tmem63b	A	T	17: 45,661,477	Y735N	possibly damaging	Het
Tmprss11a	C	T	5: 86,420,079	C263Y	probably damaging	Het
Trio	A	T	15: 27,897,991	V345E	probably damaging	Het
Ubr5	A	G	15: 37,997,916	S1674P	probably damaging	Het
Uchl3	T	A	14: 101,695,917	C209S	probably damaging	Het
Uhmk1	T	C	1: 170,211,167	N206S	probably damaging	Het
Uhrf1	C	T	17: 56,318,340	R588W	probably damaging	Het
Usp28	T	C	9: 49,010,250	V256A	probably damaging	Het
Utrn	C	A	10: 12,728,777	L552F	probably damaging	Het
Vmn1r55	A	T	7: 5,146,986	M146K	probably damaging	Het
Vmn1r57	A	C	7: 5,221,108	I211L	probably benign	Het
Zar1	C	T	5: 72,577,399	C316Y	probably damaging	Het
Zc3h11a	A	T	1: 133,621,674	S750T	probably damaging	Het
Zcchc6	A	G	13: 59,816,656		probably null	Het
Zfp366	G	A	13: 99,246,168	C613Y	probably benign	Het
Zfp37	A	T	4: 62,191,256	C524S	probably damaging	Het
Zfp516	T	C	18: 82,957,093	V472A	probably benign	Het
Zhx1	A	T	15: 58,052,423	M809K	probably damaging	Het
Zic1	T	C	9: 91,364,371	Y216C	probably damaging	Het

Other mutations in Cd177

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Cd177	APN	7	24759751	missense	possibly damaging	0.59
IGL00479:Cd177	APN	7	24758015	missense	probably benign	0.05
IGL00673:Cd177	APN	7	24752017	missense	possibly damaging	0.78
IGL00913:Cd177	APN	7	24756195	missense	probably damaging	1.00
IGL01445:Cd177	APN	7	24752071	missense	possibly damaging	0.95
IGL02021:Cd177	APN	7	24745206	missense	probably benign	0.16
IGL02134:Cd177	APN	7	24752352	missense	probably benign	0.01
IGL02532:Cd177	APN	7	24745249	missense	probably benign	0.30
IGL02821:Cd177	APN	7	24744393	missense	probably damaging	1.00
IGL02821:Cd177	APN	7	24744394	missense	probably damaging	1.00
IGL02888:Cd177	APN	7	24758437	missense	probably damaging	0.99
R0506:Cd177	UTSW	7	24758356	missense	probably damaging	1.00
R0601:Cd177	UTSW	7	24752313	missense	probably benign	0.00
R0631:Cd177	UTSW	7	24756686	missense	probably benign	0.03
R0713:Cd177	UTSW	7	24744430	missense	probably benign	0.25
R1595:Cd177	UTSW	7	24744964	missense	probably benign
R1659:Cd177	UTSW	7	24746137	missense	probably damaging	1.00
R2258:Cd177	UTSW	7	24756236	missense	possibly damaging	0.73
R2260:Cd177	UTSW	7	24756236	missense	possibly damaging	0.73
R2379:Cd177	UTSW	7	24758043	missense	possibly damaging	0.80
R2763:Cd177	UTSW	7	24758037	missense	probably benign	0.05
R2929:Cd177	UTSW	7	24754279	nonsense	probably null
R3815:Cd177	UTSW	7	24754392	missense	probably benign	0.00
R3818:Cd177	UTSW	7	24754392	missense	probably benign	0.00
R3919:Cd177	UTSW	7	24744433	missense	probably benign	0.15
R4300:Cd177	UTSW	7	24750420	missense	possibly damaging	0.48
R4494:Cd177	UTSW	7	24752003	missense	probably benign	0.06
R4781:Cd177	UTSW	7	24750626	missense	probably damaging	1.00
R4819:Cd177	UTSW	7	24752271	missense	probably damaging	1.00
R5062:Cd177	UTSW	7	24744316	missense	probably benign	0.03
R5285:Cd177	UTSW	7	24746249	missense	probably benign	0.00
R5415:Cd177	UTSW	7	24752391	missense	probably damaging	1.00
R5577:Cd177	UTSW	7	24745137	missense	probably damaging	1.00
R5637:Cd177	UTSW	7	24756323	missense	probably benign	0.01
R5673:Cd177	UTSW	7	24750362	missense	probably damaging	1.00
R5731:Cd177	UTSW	7	24744421	missense	probably damaging	1.00
R5775:Cd177	UTSW	7	24752268	missense	probably damaging	1.00
R5840:Cd177	UTSW	7	24758070	missense	probably damaging	0.99
R5870:Cd177	UTSW	7	24756332	missense	probably benign	0.00
R5872:Cd177	UTSW	7	24752263	missense	probably null	1.00
R6148:Cd177	UTSW	7	24744273	nonsense	probably null
R6505:Cd177	UTSW	7	24744246	missense	probably benign	0.00
R6897:Cd177	UTSW	7	24745074	missense	probably benign	0.31
R7023:Cd177	UTSW	7	24759762	missense	probably benign	0.44
R7088:Cd177	UTSW	7	24745133	nonsense	probably null
R7188:Cd177	UTSW	7	24756647	missense	probably damaging	1.00
R7366:Cd177	UTSW	7	24756722	missense	probably damaging	1.00
R7744:Cd177	UTSW	7	24750375	missense	probably damaging	1.00
R8008:Cd177	UTSW	7	24752349	missense	not run
R8029:Cd177	UTSW	7	24756169	nonsense	probably null
R8030:Cd177	UTSW	7	24756169	nonsense	probably null
R8032:Cd177	UTSW	7	24756169	nonsense	probably null
R8094:Cd177	UTSW	7	24744417	missense	probably damaging	0.99
R8121:Cd177	UTSW	7	24759642	missense	probably benign
R8192:Cd177	UTSW	7	24754302	missense	probably benign	0.00
R8314:Cd177	UTSW	7	24750588	missense	probably benign	0.15
Z1176:Cd177	UTSW	7	24746171	missense	probably benign	0.01
Z1177:Cd177	UTSW	7	24760256	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGCCTCTTCCATCTGAGAC -3'
(R):5'- GACAGCAGCAGTGTCCTTCTAAG -3'

Sequencing Primer
(F):5'- CCCTCAGACTTTGGAGTTAGCG -3'
(R):5'- AGCAGTGTCCTTCTAAGCATCC -3'

Posted On

2016-07-06