Incidental Mutation 'R5186:Olfr654'
ID397885
Institutional Source Beutler Lab
Gene Symbol Olfr654
Ensembl Gene ENSMUSG00000073925
Gene Nameolfactory receptor 654
SynonymsGA_x6K02T2PBJ9-7215221-7216195, MOR38-2
MMRRC Submission 042765-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5186 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104587025-104590718 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104588211 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 153 (I153F)
Ref Sequence ENSEMBL: ENSMUSP00000095775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098173] [ENSMUST00000210457] [ENSMUST00000213984] [ENSMUST00000215585] [ENSMUST00000217466]
Predicted Effect probably damaging
Transcript: ENSMUST00000098173
AA Change: I153F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000095775
Gene: ENSMUSG00000073925
AA Change: I153F

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
Pfam:7TM_GPCR_Srbc 43 176 2.5e-8 PFAM
Pfam:7tm_4 49 328 1.7e-103 PFAM
Pfam:7TM_GPCR_Srsx 53 325 1.6e-7 PFAM
Pfam:7tm_1 59 310 9.2e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000210457
AA Change: I136F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000213984
AA Change: I136F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000215585
Predicted Effect probably benign
Transcript: ENSMUST00000217466
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,743,739 L89H probably damaging Het
Abca8a T C 11: 110,091,599 I6V probably null Het
Aox1 A G 1: 58,068,370 D601G probably damaging Het
Asic1 GCACC GCACCACC 15: 99,698,803 probably benign Het
Cacna1g T G 11: 94,442,848 N931T probably damaging Het
Ccdc14 T C 16: 34,721,585 F511L probably damaging Het
Cd177 T A 7: 24,744,923 E710V probably benign Het
Cep112 T C 11: 108,752,560 C49R probably benign Het
Clip2 G A 5: 134,522,791 T159M possibly damaging Het
Dnah2 T C 11: 69,435,884 N3575S probably damaging Het
Dnah6 T A 6: 73,067,427 I3234F probably damaging Het
Eci3 G T 13: 34,946,978 A302E possibly damaging Het
Fam204a T C 19: 60,199,989 K214E probably damaging Het
Fam78a T C 2: 32,082,654 T85A possibly damaging Het
Flnb T C 14: 7,909,748 Y1401H probably damaging Het
Foxl2 A T 9: 98,956,055 D132V probably damaging Het
Frs2 C A 10: 117,078,842 W57C probably damaging Het
Gm26558 G T 2: 70,661,417 probably benign Het
Gpr139 A G 7: 119,144,840 V174A probably benign Het
Grik5 T C 7: 25,015,819 T676A probably damaging Het
H60c T C 10: 3,259,273 probably null Het
Hspa1l A G 17: 34,978,469 K495E probably damaging Het
Irgm1 C T 11: 48,866,217 V256I probably benign Het
Kat7 T A 11: 95,286,416 T293S probably benign Het
Lipg C T 18: 74,960,938 V13I probably benign Het
Lrrn1 A T 6: 107,569,224 Y661F probably damaging Het
Mllt3 A G 4: 87,840,995 V272A probably benign Het
Mx1 G A 16: 97,455,494 R162C probably benign Het
Myo18b T A 5: 112,871,470 D647V probably damaging Het
Naf1 G A 8: 66,879,646 V329I probably benign Het
Olfr1286 A T 2: 111,420,774 M59K probably damaging Het
Olfr936 A T 9: 39,046,969 C194* probably null Het
P2rx5 G A 11: 73,171,790 V442M possibly damaging Het
Pcdhb9 A G 18: 37,401,232 E93G probably damaging Het
Pcdhga4 A T 18: 37,687,426 N676I probably benign Het
Pgm5 A G 19: 24,820,128 M230T probably damaging Het
Pik3c2g T C 6: 139,622,018 V44A probably damaging Het
Pp2d1 T C 17: 53,508,140 M519V probably benign Het
Ppp1r10 A G 17: 35,928,511 E404G probably damaging Het
Prpf8 A T 11: 75,489,783 E104V possibly damaging Het
Ptpa T C 2: 30,438,355 probably null Het
Pygl A C 12: 70,201,344 N248K probably damaging Het
Rbm8a A G 3: 96,630,932 D102G probably damaging Het
Sema3d A G 5: 12,584,908 D647G probably benign Het
Serpinb11 A T 1: 107,379,754 D305V probably damaging Het
Slc12a8 T C 16: 33,617,208 I337T probably damaging Het
Slc29a2 G A 19: 5,028,967 R286Q probably benign Het
Slc2a3 T A 6: 122,735,583 D234V probably damaging Het
Slco4a1 T C 2: 180,473,108 V608A probably damaging Het
Srrm2 C T 17: 23,816,587 T831I probably benign Het
St18 T A 1: 6,802,317 probably null Het
Tesk2 G C 4: 116,741,896 G67A probably damaging Het
Tlr1 A T 5: 64,925,221 L671H probably damaging Het
Tmem63b A T 17: 45,661,477 Y735N possibly damaging Het
Tmprss11a C T 5: 86,420,079 C263Y probably damaging Het
Trio A T 15: 27,897,991 V345E probably damaging Het
Ubr5 A G 15: 37,997,916 S1674P probably damaging Het
Uchl3 T A 14: 101,695,917 C209S probably damaging Het
Uhmk1 T C 1: 170,211,167 N206S probably damaging Het
Uhrf1 C T 17: 56,318,340 R588W probably damaging Het
Usp28 T C 9: 49,010,250 V256A probably damaging Het
Utrn C A 10: 12,728,777 L552F probably damaging Het
Vmn1r55 A T 7: 5,146,986 M146K probably damaging Het
Vmn1r57 A C 7: 5,221,108 I211L probably benign Het
Zar1 C T 5: 72,577,399 C316Y probably damaging Het
Zc3h11a A T 1: 133,621,674 S750T probably damaging Het
Zcchc6 A G 13: 59,816,656 probably null Het
Zfp366 G A 13: 99,246,168 C613Y probably benign Het
Zfp37 A T 4: 62,191,256 C524S probably damaging Het
Zfp516 T C 18: 82,957,093 V472A probably benign Het
Zhx1 A T 15: 58,052,423 M809K probably damaging Het
Zic1 T C 9: 91,364,371 Y216C probably damaging Het
Other mutations in Olfr654
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Olfr654 APN 7 104587860 missense probably damaging 1.00
IGL01677:Olfr654 APN 7 104588145 missense probably damaging 0.97
IGL01807:Olfr654 APN 7 104587884 missense probably damaging 1.00
IGL03113:Olfr654 APN 7 104588733 missense probably benign 0.01
R0504:Olfr654 UTSW 7 104588475 nonsense probably null
R0647:Olfr654 UTSW 7 104588115 missense probably damaging 1.00
R0941:Olfr654 UTSW 7 104588338 missense probably damaging 1.00
R0945:Olfr654 UTSW 7 104588672 missense probably damaging 1.00
R1423:Olfr654 UTSW 7 104588475 nonsense probably null
R1860:Olfr654 UTSW 7 104587905 missense probably damaging 0.98
R2872:Olfr654 UTSW 7 104588493 missense possibly damaging 0.87
R2872:Olfr654 UTSW 7 104588493 missense possibly damaging 0.87
R4082:Olfr654 UTSW 7 104588623 missense probably damaging 1.00
R4760:Olfr654 UTSW 7 104588489 missense probably benign 0.32
R4787:Olfr654 UTSW 7 104587960 missense probably benign
R4969:Olfr654 UTSW 7 104588523 missense probably damaging 1.00
R5706:Olfr654 UTSW 7 104587890 missense probably benign 0.02
R6582:Olfr654 UTSW 7 104588011 missense probably damaging 1.00
R7076:Olfr654 UTSW 7 104588223 missense probably damaging 1.00
R7155:Olfr654 UTSW 7 104588557 missense possibly damaging 0.88
R7424:Olfr654 UTSW 7 104588700 missense probably damaging 1.00
R7559:Olfr654 UTSW 7 104587880 missense probably damaging 1.00
R7722:Olfr654 UTSW 7 104588298 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TGCACAAGCCCATGTTCCTG -3'
(R):5'- GGTATCGACACATACCATCTTCACC -3'

Sequencing Primer
(F):5'- CACAGACTTGGGTATGTCTACGAC -3'
(R):5'- TACCATCTTCACCACAGCCATG -3'
Posted On2016-07-06