Incidental Mutation 'R5186:Prpf8'
ID397898
Institutional Source Beutler Lab
Gene Symbol Prpf8
Ensembl Gene ENSMUSG00000020850
Gene Namepre-mRNA processing factor 8
SynonymsSfprp8l, D11Bwg0410e, DBF3/PRP8, Prp8
MMRRC Submission 042765-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R5186 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location75486816-75509449 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75489783 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 104 (E104V)
Ref Sequence ENSEMBL: ENSMUSP00000099568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018449] [ENSMUST00000102510] [ENSMUST00000131283]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018449
AA Change: E104V

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000018449
Gene: ENSMUSG00000020850
AA Change: E104V

DomainStartEndE-ValueType
Pfam:PRO8NT 58 209 1.6e-84 PFAM
low complexity region 369 388 N/A INTRINSIC
Pfam:PROCN 393 801 3.6e-226 PFAM
low complexity region 802 814 N/A INTRINSIC
Pfam:RRM_4 986 1079 7.1e-49 PFAM
Pfam:U5_2-snRNA_bdg 1208 1343 1.9e-73 PFAM
Pfam:U6-snRNA_bdg 1442 1601 3.7e-97 PFAM
Pfam:PRP8_domainIV 1760 1990 1.5e-132 PFAM
JAB_MPN 2099 2233 9.02e-30 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102510
AA Change: E104V

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099568
Gene: ENSMUSG00000020850
AA Change: E104V

DomainStartEndE-ValueType
Pfam:PRO8NT 58 209 1.6e-90 PFAM
low complexity region 369 388 N/A INTRINSIC
Pfam:PROCN 395 801 2.9e-239 PFAM
low complexity region 802 814 N/A INTRINSIC
Pfam:RRM_4 986 1077 1.5e-51 PFAM
Pfam:U5_2-snRNA_bdg 1210 1343 1.1e-77 PFAM
Pfam:U6-snRNA_bdg 1442 1600 4.2e-97 PFAM
Pfam:PRP8_domainIV 1760 1989 9.8e-134 PFAM
JAB_MPN 2099 2233 9.02e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131283
SMART Domains Protein: ENSMUSP00000115635
Gene: ENSMUSG00000020850

DomainStartEndE-ValueType
Pfam:PRO8NT 58 92 1.9e-13 PFAM
Pfam:PRO8NT 90 154 2.5e-30 PFAM
low complexity region 314 333 N/A INTRINSIC
Pfam:PROCN 338 746 1.7e-226 PFAM
low complexity region 747 759 N/A INTRINSIC
Pfam:RRM_4 931 1024 5.3e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133995
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing occurs in 2 sequential transesterification steps. The protein encoded by this gene is a component of both U2- and U12-dependent spliceosomes, and found to be essential for the catalytic step II in pre-mRNA splicing process. It contains several WD repeats, which function in protein-protein interactions. This protein has a sequence similarity to yeast Prp8 protein. This gene is a candidate gene for autosomal dominant retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that are either heterozygous or homozygous for a knock-in allele exhibit abnormal retinal pigment epithelium morphology and late-onset retinal degeneration. These changes are more severe in homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,743,739 L89H probably damaging Het
Abca8a T C 11: 110,091,599 I6V probably null Het
Aox1 A G 1: 58,068,370 D601G probably damaging Het
Asic1 GCACC GCACCACC 15: 99,698,803 probably benign Het
Cacna1g T G 11: 94,442,848 N931T probably damaging Het
Ccdc14 T C 16: 34,721,585 F511L probably damaging Het
Cd177 T A 7: 24,744,923 E710V probably benign Het
Cep112 T C 11: 108,752,560 C49R probably benign Het
Clip2 G A 5: 134,522,791 T159M possibly damaging Het
Dnah2 T C 11: 69,435,884 N3575S probably damaging Het
Dnah6 T A 6: 73,067,427 I3234F probably damaging Het
Eci3 G T 13: 34,946,978 A302E possibly damaging Het
Fam204a T C 19: 60,199,989 K214E probably damaging Het
Fam78a T C 2: 32,082,654 T85A possibly damaging Het
Flnb T C 14: 7,909,748 Y1401H probably damaging Het
Foxl2 A T 9: 98,956,055 D132V probably damaging Het
Frs2 C A 10: 117,078,842 W57C probably damaging Het
Gm26558 G T 2: 70,661,417 probably benign Het
Gpr139 A G 7: 119,144,840 V174A probably benign Het
Grik5 T C 7: 25,015,819 T676A probably damaging Het
H60c T C 10: 3,259,273 probably null Het
Hspa1l A G 17: 34,978,469 K495E probably damaging Het
Irgm1 C T 11: 48,866,217 V256I probably benign Het
Kat7 T A 11: 95,286,416 T293S probably benign Het
Lipg C T 18: 74,960,938 V13I probably benign Het
Lrrn1 A T 6: 107,569,224 Y661F probably damaging Het
Mllt3 A G 4: 87,840,995 V272A probably benign Het
Mx1 G A 16: 97,455,494 R162C probably benign Het
Myo18b T A 5: 112,871,470 D647V probably damaging Het
Naf1 G A 8: 66,879,646 V329I probably benign Het
Olfr1286 A T 2: 111,420,774 M59K probably damaging Het
Olfr654 A T 7: 104,588,211 I153F probably damaging Het
Olfr936 A T 9: 39,046,969 C194* probably null Het
P2rx5 G A 11: 73,171,790 V442M possibly damaging Het
Pcdhb9 A G 18: 37,401,232 E93G probably damaging Het
Pcdhga4 A T 18: 37,687,426 N676I probably benign Het
Pgm5 A G 19: 24,820,128 M230T probably damaging Het
Pik3c2g T C 6: 139,622,018 V44A probably damaging Het
Pp2d1 T C 17: 53,508,140 M519V probably benign Het
Ppp1r10 A G 17: 35,928,511 E404G probably damaging Het
Ptpa T C 2: 30,438,355 probably null Het
Pygl A C 12: 70,201,344 N248K probably damaging Het
Rbm8a A G 3: 96,630,932 D102G probably damaging Het
Sema3d A G 5: 12,584,908 D647G probably benign Het
Serpinb11 A T 1: 107,379,754 D305V probably damaging Het
Slc12a8 T C 16: 33,617,208 I337T probably damaging Het
Slc29a2 G A 19: 5,028,967 R286Q probably benign Het
Slc2a3 T A 6: 122,735,583 D234V probably damaging Het
Slco4a1 T C 2: 180,473,108 V608A probably damaging Het
Srrm2 C T 17: 23,816,587 T831I probably benign Het
St18 T A 1: 6,802,317 probably null Het
Tesk2 G C 4: 116,741,896 G67A probably damaging Het
Tlr1 A T 5: 64,925,221 L671H probably damaging Het
Tmem63b A T 17: 45,661,477 Y735N possibly damaging Het
Tmprss11a C T 5: 86,420,079 C263Y probably damaging Het
Trio A T 15: 27,897,991 V345E probably damaging Het
Ubr5 A G 15: 37,997,916 S1674P probably damaging Het
Uchl3 T A 14: 101,695,917 C209S probably damaging Het
Uhmk1 T C 1: 170,211,167 N206S probably damaging Het
Uhrf1 C T 17: 56,318,340 R588W probably damaging Het
Usp28 T C 9: 49,010,250 V256A probably damaging Het
Utrn C A 10: 12,728,777 L552F probably damaging Het
Vmn1r55 A T 7: 5,146,986 M146K probably damaging Het
Vmn1r57 A C 7: 5,221,108 I211L probably benign Het
Zar1 C T 5: 72,577,399 C316Y probably damaging Het
Zc3h11a A T 1: 133,621,674 S750T probably damaging Het
Zcchc6 A G 13: 59,816,656 probably null Het
Zfp366 G A 13: 99,246,168 C613Y probably benign Het
Zfp37 A T 4: 62,191,256 C524S probably damaging Het
Zfp516 T C 18: 82,957,093 V472A probably benign Het
Zhx1 A T 15: 58,052,423 M809K probably damaging Het
Zic1 T C 9: 91,364,371 Y216C probably damaging Het
Other mutations in Prpf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Prpf8 APN 11 75494295 missense possibly damaging 0.94
IGL01376:Prpf8 APN 11 75494295 missense possibly damaging 0.94
IGL01393:Prpf8 APN 11 75494295 missense possibly damaging 0.94
IGL01395:Prpf8 APN 11 75494295 missense possibly damaging 0.94
IGL01554:Prpf8 APN 11 75495646 missense probably damaging 1.00
IGL01560:Prpf8 APN 11 75490406 missense possibly damaging 0.55
IGL01886:Prpf8 APN 11 75495744 missense probably benign 0.32
IGL01946:Prpf8 APN 11 75499992 missense probably damaging 1.00
IGL02022:Prpf8 APN 11 75501834 nonsense probably null
IGL02077:Prpf8 APN 11 75495809 missense probably damaging 0.96
IGL02141:Prpf8 APN 11 75490672 missense possibly damaging 0.68
IGL02455:Prpf8 APN 11 75509258 missense probably benign 0.32
cutter UTSW 11 75495426 splice site probably null
BB009:Prpf8 UTSW 11 75492597 missense possibly damaging 0.92
BB019:Prpf8 UTSW 11 75492597 missense possibly damaging 0.92
PIT4514001:Prpf8 UTSW 11 75496355 missense possibly damaging 0.53
R0254:Prpf8 UTSW 11 75506362 missense possibly damaging 0.93
R0270:Prpf8 UTSW 11 75505249 missense probably damaging 0.99
R0504:Prpf8 UTSW 11 75501942 splice site probably benign
R0573:Prpf8 UTSW 11 75490654 missense probably damaging 1.00
R0613:Prpf8 UTSW 11 75503444 missense probably damaging 1.00
R0893:Prpf8 UTSW 11 75493949 missense probably damaging 1.00
R0967:Prpf8 UTSW 11 75494430 missense probably damaging 1.00
R0975:Prpf8 UTSW 11 75508674 unclassified probably benign
R1123:Prpf8 UTSW 11 75495285 missense probably damaging 1.00
R1183:Prpf8 UTSW 11 75490330 missense possibly damaging 0.95
R1857:Prpf8 UTSW 11 75495423 critical splice donor site probably null
R1901:Prpf8 UTSW 11 75504744 missense probably damaging 0.99
R1950:Prpf8 UTSW 11 75496511 missense possibly damaging 0.72
R2116:Prpf8 UTSW 11 75487721 missense possibly damaging 0.51
R2147:Prpf8 UTSW 11 75490531 missense probably benign
R2185:Prpf8 UTSW 11 75487113 nonsense probably null
R2271:Prpf8 UTSW 11 75495363 missense probably damaging 1.00
R2272:Prpf8 UTSW 11 75495363 missense probably damaging 1.00
R2898:Prpf8 UTSW 11 75496034 missense probably benign 0.00
R3744:Prpf8 UTSW 11 75506721 splice site probably null
R3893:Prpf8 UTSW 11 75500257 missense possibly damaging 0.73
R4400:Prpf8 UTSW 11 75490702 missense possibly damaging 0.63
R4510:Prpf8 UTSW 11 75491826 missense probably damaging 0.96
R4511:Prpf8 UTSW 11 75491826 missense probably damaging 0.96
R4784:Prpf8 UTSW 11 75492505 missense probably damaging 1.00
R5089:Prpf8 UTSW 11 75509228 splice site probably null
R5215:Prpf8 UTSW 11 75500204 missense probably benign 0.02
R5288:Prpf8 UTSW 11 75495799 missense probably damaging 1.00
R5362:Prpf8 UTSW 11 75506410 missense possibly damaging 0.53
R5384:Prpf8 UTSW 11 75495799 missense probably damaging 1.00
R5386:Prpf8 UTSW 11 75495799 missense probably damaging 1.00
R5423:Prpf8 UTSW 11 75508958 missense probably damaging 1.00
R5472:Prpf8 UTSW 11 75503643 missense possibly damaging 0.89
R5539:Prpf8 UTSW 11 75503638 missense probably benign 0.20
R5620:Prpf8 UTSW 11 75505101 missense possibly damaging 0.95
R5669:Prpf8 UTSW 11 75504738 missense probably damaging 1.00
R5887:Prpf8 UTSW 11 75500908 missense possibly damaging 0.87
R5948:Prpf8 UTSW 11 75509189 missense possibly damaging 0.95
R6073:Prpf8 UTSW 11 75494022 critical splice donor site probably null
R6250:Prpf8 UTSW 11 75493508 missense possibly damaging 0.95
R6358:Prpf8 UTSW 11 75491495 missense probably benign 0.33
R6629:Prpf8 UTSW 11 75495426 splice site probably null
R6804:Prpf8 UTSW 11 75499809 missense possibly damaging 0.71
R6922:Prpf8 UTSW 11 75490736 missense probably damaging 1.00
R7035:Prpf8 UTSW 11 75504828 missense possibly damaging 0.72
R7038:Prpf8 UTSW 11 75496158 missense probably benign 0.02
R7089:Prpf8 UTSW 11 75508548 missense probably damaging 0.99
R7101:Prpf8 UTSW 11 75490400 missense possibly damaging 0.85
R7114:Prpf8 UTSW 11 75503355 nonsense probably null
R7182:Prpf8 UTSW 11 75490727 missense possibly damaging 0.96
R7290:Prpf8 UTSW 11 75493957 missense possibly damaging 0.85
R7323:Prpf8 UTSW 11 75491784 missense probably benign 0.32
R7485:Prpf8 UTSW 11 75508912 nonsense probably null
R7522:Prpf8 UTSW 11 75509276 missense possibly damaging 0.82
R7546:Prpf8 UTSW 11 75508374 missense probably damaging 1.00
R7596:Prpf8 UTSW 11 75491504 missense probably benign 0.03
R7699:Prpf8 UTSW 11 75500196 missense probably benign 0.02
R7731:Prpf8 UTSW 11 75508906 missense probably damaging 0.97
R7821:Prpf8 UTSW 11 75494474 missense probably benign 0.01
R7932:Prpf8 UTSW 11 75492597 missense possibly damaging 0.92
R8039:Prpf8 UTSW 11 75502542 missense possibly damaging 0.95
R8067:Prpf8 UTSW 11 75500150 missense probably damaging 0.98
R8316:Prpf8 UTSW 11 75499815 missense possibly damaging 0.71
R8560:Prpf8 UTSW 11 75491774 nonsense probably null
R8823:Prpf8 UTSW 11 75493456 missense probably benign 0.05
X0028:Prpf8 UTSW 11 75506764 missense probably damaging 0.99
Z1177:Prpf8 UTSW 11 75503334 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- AGGACTTGTGATCGTGTAGGAC -3'
(R):5'- CAAGAGCATCATGTCCACTGATC -3'

Sequencing Primer
(F):5'- ACTTGTGATCGTGTAGGACCTTAGTC -3'
(R):5'- TGATCTCAGCTGCAACACC -3'
Posted On2016-07-06