Incidental Mutation 'R5186:Prpf8'
ID 397898
Institutional Source Beutler Lab
Gene Symbol Prpf8
Ensembl Gene ENSMUSG00000020850
Gene Name pre-mRNA processing factor 8
Synonyms Sfprp8l, D11Bwg0410e, DBF3/PRP8, Prp8
MMRRC Submission 042765-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.958) question?
Stock # R5186 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 75377642-75400275 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 75380609 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 104 (E104V)
Ref Sequence ENSEMBL: ENSMUSP00000099568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018449] [ENSMUST00000102510] [ENSMUST00000131283]
AlphaFold Q99PV0
Predicted Effect possibly damaging
Transcript: ENSMUST00000018449
AA Change: E104V

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000018449
Gene: ENSMUSG00000020850
AA Change: E104V

DomainStartEndE-ValueType
Pfam:PRO8NT 58 209 1.6e-84 PFAM
low complexity region 369 388 N/A INTRINSIC
Pfam:PROCN 393 801 3.6e-226 PFAM
low complexity region 802 814 N/A INTRINSIC
Pfam:RRM_4 986 1079 7.1e-49 PFAM
Pfam:U5_2-snRNA_bdg 1208 1343 1.9e-73 PFAM
Pfam:U6-snRNA_bdg 1442 1601 3.7e-97 PFAM
Pfam:PRP8_domainIV 1760 1990 1.5e-132 PFAM
JAB_MPN 2099 2233 9.02e-30 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102510
AA Change: E104V

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099568
Gene: ENSMUSG00000020850
AA Change: E104V

DomainStartEndE-ValueType
Pfam:PRO8NT 58 209 1.6e-90 PFAM
low complexity region 369 388 N/A INTRINSIC
Pfam:PROCN 395 801 2.9e-239 PFAM
low complexity region 802 814 N/A INTRINSIC
Pfam:RRM_4 986 1077 1.5e-51 PFAM
Pfam:U5_2-snRNA_bdg 1210 1343 1.1e-77 PFAM
Pfam:U6-snRNA_bdg 1442 1600 4.2e-97 PFAM
Pfam:PRP8_domainIV 1760 1989 9.8e-134 PFAM
JAB_MPN 2099 2233 9.02e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131283
SMART Domains Protein: ENSMUSP00000115635
Gene: ENSMUSG00000020850

DomainStartEndE-ValueType
Pfam:PRO8NT 58 92 1.9e-13 PFAM
Pfam:PRO8NT 90 154 2.5e-30 PFAM
low complexity region 314 333 N/A INTRINSIC
Pfam:PROCN 338 746 1.7e-226 PFAM
low complexity region 747 759 N/A INTRINSIC
Pfam:RRM_4 931 1024 5.3e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133995
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing occurs in 2 sequential transesterification steps. The protein encoded by this gene is a component of both U2- and U12-dependent spliceosomes, and found to be essential for the catalytic step II in pre-mRNA splicing process. It contains several WD repeats, which function in protein-protein interactions. This protein has a sequence similarity to yeast Prp8 protein. This gene is a candidate gene for autosomal dominant retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that are either heterozygous or homozygous for a knock-in allele exhibit abnormal retinal pigment epithelium morphology and late-onset retinal degeneration. These changes are more severe in homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 109,982,425 (GRCm39) I6V probably null Het
Aox1 A G 1: 58,107,529 (GRCm39) D601G probably damaging Het
Asic1 GCACC GCACCACC 15: 99,596,684 (GRCm39) probably benign Het
Cacna1g T G 11: 94,333,674 (GRCm39) N931T probably damaging Het
Ccdc14 T C 16: 34,541,955 (GRCm39) F511L probably damaging Het
Cd177 T A 7: 24,444,348 (GRCm39) E710V probably benign Het
Cep112 T C 11: 108,643,386 (GRCm39) C49R probably benign Het
Clip2 G A 5: 134,551,645 (GRCm39) T159M possibly damaging Het
Dnah2 T C 11: 69,326,710 (GRCm39) N3575S probably damaging Het
Dnah6 T A 6: 73,044,410 (GRCm39) I3234F probably damaging Het
Eci3 G T 13: 35,130,961 (GRCm39) A302E possibly damaging Het
Fam204a T C 19: 60,188,421 (GRCm39) K214E probably damaging Het
Fam78a T C 2: 31,972,666 (GRCm39) T85A possibly damaging Het
Flnb T C 14: 7,909,748 (GRCm38) Y1401H probably damaging Het
Foxl2 A T 9: 98,838,108 (GRCm39) D132V probably damaging Het
Frs2 C A 10: 116,914,747 (GRCm39) W57C probably damaging Het
Gm26558 G T 2: 70,491,761 (GRCm39) probably benign Het
Gpr139 A G 7: 118,744,063 (GRCm39) V174A probably benign Het
Grik5 T C 7: 24,715,244 (GRCm39) T676A probably damaging Het
H60c T C 10: 3,209,273 (GRCm39) probably null Het
Hspa1l A G 17: 35,197,445 (GRCm39) K495E probably damaging Het
Irgm1 C T 11: 48,757,044 (GRCm39) V256I probably benign Het
Kat7 T A 11: 95,177,242 (GRCm39) T293S probably benign Het
Lipg C T 18: 75,094,009 (GRCm39) V13I probably benign Het
Lrrn1 A T 6: 107,546,185 (GRCm39) Y661F probably damaging Het
Mllt3 A G 4: 87,759,232 (GRCm39) V272A probably benign Het
Mx1 G A 16: 97,256,694 (GRCm39) R162C probably benign Het
Myo18b T A 5: 113,019,336 (GRCm39) D647V probably damaging Het
Naf1 G A 8: 67,332,298 (GRCm39) V329I probably benign Het
Or4k40 A T 2: 111,251,119 (GRCm39) M59K probably damaging Het
Or52u1 A T 7: 104,237,418 (GRCm39) I153F probably damaging Het
Or8g22 A T 9: 38,958,265 (GRCm39) C194* probably null Het
P2rx5 G A 11: 73,062,616 (GRCm39) V442M possibly damaging Het
Pcdhb9 A G 18: 37,534,285 (GRCm39) E93G probably damaging Het
Pcdhga4 A T 18: 37,820,479 (GRCm39) N676I probably benign Het
Pgm5 A G 19: 24,797,492 (GRCm39) M230T probably damaging Het
Pik3c2g T C 6: 139,599,016 (GRCm39) V44A probably damaging Het
Pp2d1 T C 17: 53,815,168 (GRCm39) M519V probably benign Het
Ppp1r10 A G 17: 36,239,403 (GRCm39) E404G probably damaging Het
Ptpra T C 2: 30,328,367 (GRCm39) probably null Het
Pygl A C 12: 70,248,118 (GRCm39) N248K probably damaging Het
Rbm8a A G 3: 96,538,248 (GRCm39) D102G probably damaging Het
Sema3d A G 5: 12,634,875 (GRCm39) D647G probably benign Het
Serpinb11 A T 1: 107,307,484 (GRCm39) D305V probably damaging Het
Slc12a8 T C 16: 33,437,578 (GRCm39) I337T probably damaging Het
Slc29a2 G A 19: 5,078,995 (GRCm39) R286Q probably benign Het
Slc2a3 T A 6: 122,712,542 (GRCm39) D234V probably damaging Het
Slco4a1 T C 2: 180,114,901 (GRCm39) V608A probably damaging Het
Spata31d1e A T 13: 59,891,553 (GRCm39) L89H probably damaging Het
Srrm2 C T 17: 24,035,561 (GRCm39) T831I probably benign Het
St18 T A 1: 6,872,541 (GRCm39) probably null Het
Tesk2 G C 4: 116,599,093 (GRCm39) G67A probably damaging Het
Tlr1 A T 5: 65,082,564 (GRCm39) L671H probably damaging Het
Tmem63b A T 17: 45,972,403 (GRCm39) Y735N possibly damaging Het
Tmprss11a C T 5: 86,567,938 (GRCm39) C263Y probably damaging Het
Trio A T 15: 27,898,077 (GRCm39) V345E probably damaging Het
Tut7 A G 13: 59,964,470 (GRCm39) probably null Het
Ubr5 A G 15: 37,998,160 (GRCm39) S1674P probably damaging Het
Uchl3 T A 14: 101,933,353 (GRCm39) C209S probably damaging Het
Uhmk1 T C 1: 170,038,736 (GRCm39) N206S probably damaging Het
Uhrf1 C T 17: 56,625,340 (GRCm39) R588W probably damaging Het
Usp28 T C 9: 48,921,550 (GRCm39) V256A probably damaging Het
Utrn C A 10: 12,604,521 (GRCm39) L552F probably damaging Het
Vmn1r55 A T 7: 5,149,985 (GRCm39) M146K probably damaging Het
Vmn1r57 A C 7: 5,224,107 (GRCm39) I211L probably benign Het
Zar1 C T 5: 72,734,742 (GRCm39) C316Y probably damaging Het
Zc3h11a A T 1: 133,549,412 (GRCm39) S750T probably damaging Het
Zfp366 G A 13: 99,382,676 (GRCm39) C613Y probably benign Het
Zfp37 A T 4: 62,109,493 (GRCm39) C524S probably damaging Het
Zfp516 T C 18: 82,975,218 (GRCm39) V472A probably benign Het
Zhx1 A T 15: 57,915,819 (GRCm39) M809K probably damaging Het
Zic1 T C 9: 91,246,424 (GRCm39) Y216C probably damaging Het
Other mutations in Prpf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Prpf8 APN 11 75,385,121 (GRCm39) missense possibly damaging 0.94
IGL01376:Prpf8 APN 11 75,385,121 (GRCm39) missense possibly damaging 0.94
IGL01393:Prpf8 APN 11 75,385,121 (GRCm39) missense possibly damaging 0.94
IGL01395:Prpf8 APN 11 75,385,121 (GRCm39) missense possibly damaging 0.94
IGL01554:Prpf8 APN 11 75,386,472 (GRCm39) missense probably damaging 1.00
IGL01560:Prpf8 APN 11 75,381,232 (GRCm39) missense possibly damaging 0.55
IGL01886:Prpf8 APN 11 75,386,570 (GRCm39) missense probably benign 0.32
IGL01946:Prpf8 APN 11 75,390,818 (GRCm39) missense probably damaging 1.00
IGL02022:Prpf8 APN 11 75,392,660 (GRCm39) nonsense probably null
IGL02077:Prpf8 APN 11 75,386,635 (GRCm39) missense probably damaging 0.96
IGL02141:Prpf8 APN 11 75,381,498 (GRCm39) missense possibly damaging 0.68
IGL02455:Prpf8 APN 11 75,400,084 (GRCm39) missense probably benign 0.32
cutter UTSW 11 75,386,252 (GRCm39) splice site probably null
BB009:Prpf8 UTSW 11 75,383,423 (GRCm39) missense possibly damaging 0.92
BB019:Prpf8 UTSW 11 75,383,423 (GRCm39) missense possibly damaging 0.92
PIT4514001:Prpf8 UTSW 11 75,387,181 (GRCm39) missense possibly damaging 0.53
R0254:Prpf8 UTSW 11 75,397,188 (GRCm39) missense possibly damaging 0.93
R0270:Prpf8 UTSW 11 75,396,075 (GRCm39) missense probably damaging 0.99
R0504:Prpf8 UTSW 11 75,392,768 (GRCm39) splice site probably benign
R0573:Prpf8 UTSW 11 75,381,480 (GRCm39) missense probably damaging 1.00
R0613:Prpf8 UTSW 11 75,394,270 (GRCm39) missense probably damaging 1.00
R0893:Prpf8 UTSW 11 75,384,775 (GRCm39) missense probably damaging 1.00
R0967:Prpf8 UTSW 11 75,385,256 (GRCm39) missense probably damaging 1.00
R0975:Prpf8 UTSW 11 75,399,500 (GRCm39) unclassified probably benign
R1123:Prpf8 UTSW 11 75,386,111 (GRCm39) missense probably damaging 1.00
R1183:Prpf8 UTSW 11 75,381,156 (GRCm39) missense possibly damaging 0.95
R1857:Prpf8 UTSW 11 75,386,249 (GRCm39) critical splice donor site probably null
R1901:Prpf8 UTSW 11 75,395,570 (GRCm39) missense probably damaging 0.99
R1950:Prpf8 UTSW 11 75,387,337 (GRCm39) missense possibly damaging 0.72
R2116:Prpf8 UTSW 11 75,378,547 (GRCm39) missense possibly damaging 0.51
R2147:Prpf8 UTSW 11 75,381,357 (GRCm39) missense probably benign
R2185:Prpf8 UTSW 11 75,377,939 (GRCm39) nonsense probably null
R2271:Prpf8 UTSW 11 75,386,189 (GRCm39) missense probably damaging 1.00
R2272:Prpf8 UTSW 11 75,386,189 (GRCm39) missense probably damaging 1.00
R2898:Prpf8 UTSW 11 75,386,860 (GRCm39) missense probably benign 0.00
R3744:Prpf8 UTSW 11 75,397,547 (GRCm39) splice site probably null
R3893:Prpf8 UTSW 11 75,391,083 (GRCm39) missense possibly damaging 0.73
R4400:Prpf8 UTSW 11 75,381,528 (GRCm39) missense possibly damaging 0.63
R4510:Prpf8 UTSW 11 75,382,652 (GRCm39) missense probably damaging 0.96
R4511:Prpf8 UTSW 11 75,382,652 (GRCm39) missense probably damaging 0.96
R4784:Prpf8 UTSW 11 75,383,331 (GRCm39) missense probably damaging 1.00
R5089:Prpf8 UTSW 11 75,400,054 (GRCm39) splice site probably null
R5215:Prpf8 UTSW 11 75,391,030 (GRCm39) missense probably benign 0.02
R5288:Prpf8 UTSW 11 75,386,625 (GRCm39) missense probably damaging 1.00
R5362:Prpf8 UTSW 11 75,397,236 (GRCm39) missense possibly damaging 0.53
R5384:Prpf8 UTSW 11 75,386,625 (GRCm39) missense probably damaging 1.00
R5386:Prpf8 UTSW 11 75,386,625 (GRCm39) missense probably damaging 1.00
R5423:Prpf8 UTSW 11 75,399,784 (GRCm39) missense probably damaging 1.00
R5472:Prpf8 UTSW 11 75,394,469 (GRCm39) missense possibly damaging 0.89
R5539:Prpf8 UTSW 11 75,394,464 (GRCm39) missense probably benign 0.20
R5620:Prpf8 UTSW 11 75,395,927 (GRCm39) missense possibly damaging 0.95
R5669:Prpf8 UTSW 11 75,395,564 (GRCm39) missense probably damaging 1.00
R5887:Prpf8 UTSW 11 75,391,734 (GRCm39) missense possibly damaging 0.87
R5948:Prpf8 UTSW 11 75,400,015 (GRCm39) missense possibly damaging 0.95
R6073:Prpf8 UTSW 11 75,384,848 (GRCm39) critical splice donor site probably null
R6250:Prpf8 UTSW 11 75,384,334 (GRCm39) missense possibly damaging 0.95
R6358:Prpf8 UTSW 11 75,382,321 (GRCm39) missense probably benign 0.33
R6629:Prpf8 UTSW 11 75,386,252 (GRCm39) splice site probably null
R6804:Prpf8 UTSW 11 75,390,635 (GRCm39) missense possibly damaging 0.71
R6922:Prpf8 UTSW 11 75,381,562 (GRCm39) missense probably damaging 1.00
R7035:Prpf8 UTSW 11 75,395,654 (GRCm39) missense possibly damaging 0.72
R7038:Prpf8 UTSW 11 75,386,984 (GRCm39) missense probably benign 0.02
R7089:Prpf8 UTSW 11 75,399,374 (GRCm39) missense probably damaging 0.99
R7101:Prpf8 UTSW 11 75,381,226 (GRCm39) missense possibly damaging 0.85
R7114:Prpf8 UTSW 11 75,394,181 (GRCm39) nonsense probably null
R7182:Prpf8 UTSW 11 75,381,553 (GRCm39) missense possibly damaging 0.96
R7290:Prpf8 UTSW 11 75,384,783 (GRCm39) missense possibly damaging 0.85
R7323:Prpf8 UTSW 11 75,382,610 (GRCm39) missense probably benign 0.32
R7485:Prpf8 UTSW 11 75,399,738 (GRCm39) nonsense probably null
R7522:Prpf8 UTSW 11 75,400,102 (GRCm39) missense possibly damaging 0.82
R7546:Prpf8 UTSW 11 75,399,200 (GRCm39) missense probably damaging 1.00
R7596:Prpf8 UTSW 11 75,382,330 (GRCm39) missense probably benign 0.03
R7699:Prpf8 UTSW 11 75,391,022 (GRCm39) missense probably benign 0.02
R7731:Prpf8 UTSW 11 75,399,732 (GRCm39) missense probably damaging 0.97
R7821:Prpf8 UTSW 11 75,385,300 (GRCm39) missense probably benign 0.01
R7932:Prpf8 UTSW 11 75,383,423 (GRCm39) missense possibly damaging 0.92
R8039:Prpf8 UTSW 11 75,393,368 (GRCm39) missense possibly damaging 0.95
R8067:Prpf8 UTSW 11 75,390,976 (GRCm39) missense probably damaging 0.98
R8316:Prpf8 UTSW 11 75,390,641 (GRCm39) missense possibly damaging 0.71
R8560:Prpf8 UTSW 11 75,382,600 (GRCm39) nonsense probably null
R8823:Prpf8 UTSW 11 75,384,282 (GRCm39) missense probably benign 0.05
R8977:Prpf8 UTSW 11 75,386,870 (GRCm39) missense probably benign 0.12
R9116:Prpf8 UTSW 11 75,380,589 (GRCm39) missense possibly damaging 0.71
R9166:Prpf8 UTSW 11 75,387,340 (GRCm39) missense possibly damaging 0.53
R9360:Prpf8 UTSW 11 75,381,156 (GRCm39) missense possibly damaging 0.95
R9453:Prpf8 UTSW 11 75,397,212 (GRCm39) missense possibly damaging 0.56
R9518:Prpf8 UTSW 11 75,394,486 (GRCm39) missense possibly damaging 0.72
R9532:Prpf8 UTSW 11 75,385,608 (GRCm39) missense probably benign 0.01
R9626:Prpf8 UTSW 11 75,385,681 (GRCm39) missense possibly damaging 0.53
R9760:Prpf8 UTSW 11 75,394,257 (GRCm39) missense probably benign 0.20
X0028:Prpf8 UTSW 11 75,397,590 (GRCm39) missense probably damaging 0.99
Z1177:Prpf8 UTSW 11 75,394,160 (GRCm39) missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- AGGACTTGTGATCGTGTAGGAC -3'
(R):5'- CAAGAGCATCATGTCCACTGATC -3'

Sequencing Primer
(F):5'- ACTTGTGATCGTGTAGGACCTTAGTC -3'
(R):5'- TGATCTCAGCTGCAACACC -3'
Posted On 2016-07-06