Incidental Mutation 'R5186:Abca8a'
ID 397902
Institutional Source Beutler Lab
Gene Symbol Abca8a
Ensembl Gene ENSMUSG00000041828
Gene Name ATP-binding cassette, sub-family A (ABC1), member 8a
Synonyms
MMRRC Submission 042765-MU
Accession Numbers

Genbank: NM_153145

Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R5186 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 110025634-110095978 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 110091599 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 6 (I6V)
Ref Sequence ENSEMBL: ENSMUSP00000102275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046223] [ENSMUST00000100287] [ENSMUST00000106662] [ENSMUST00000106664]
AlphaFold Q8K442
Predicted Effect probably null
Transcript: ENSMUST00000046223
AA Change: I6V

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000045808
Gene: ENSMUSG00000041828
AA Change: I6V

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 27 416 8e-26 PFAM
AAA 505 689 6.27e-9 SMART
Pfam:ABC2_membrane_3 860 1174 6.8e-15 PFAM
transmembrane domain 1196 1218 N/A INTRINSIC
low complexity region 1246 1255 N/A INTRINSIC
low complexity region 1288 1301 N/A INTRINSIC
AAA 1313 1493 4.3e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000100287
AA Change: I6V

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097860
Gene: ENSMUSG00000041828
AA Change: I6V

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 27 416 3.9e-26 PFAM
AAA 506 690 6.27e-9 SMART
Pfam:ABC2_membrane_3 861 1175 3.3e-15 PFAM
transmembrane domain 1197 1219 N/A INTRINSIC
low complexity region 1247 1256 N/A INTRINSIC
low complexity region 1289 1302 N/A INTRINSIC
AAA 1314 1494 4.3e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106662
AA Change: I6V
SMART Domains Protein: ENSMUSP00000102273
Gene: ENSMUSG00000041828
AA Change: I6V

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106664
AA Change: I6V

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102275
Gene: ENSMUSG00000041828
AA Change: I6V

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 416 1.7e-23 PFAM
AAA 506 690 6.27e-9 SMART
Pfam:ABC2_membrane_3 861 1214 1.3e-12 PFAM
low complexity region 1247 1256 N/A INTRINSIC
low complexity region 1289 1302 N/A INTRINSIC
AAA 1314 1494 4.3e-7 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,743,739 L89H probably damaging Het
Aox1 A G 1: 58,068,370 D601G probably damaging Het
Asic1 GCACC GCACCACC 15: 99,698,803 probably benign Het
Cacna1g T G 11: 94,442,848 N931T probably damaging Het
Ccdc14 T C 16: 34,721,585 F511L probably damaging Het
Cd177 T A 7: 24,744,923 E710V probably benign Het
Cep112 T C 11: 108,752,560 C49R probably benign Het
Clip2 G A 5: 134,522,791 T159M possibly damaging Het
Dnah2 T C 11: 69,435,884 N3575S probably damaging Het
Dnah6 T A 6: 73,067,427 I3234F probably damaging Het
Eci3 G T 13: 34,946,978 A302E possibly damaging Het
Fam204a T C 19: 60,199,989 K214E probably damaging Het
Fam78a T C 2: 32,082,654 T85A possibly damaging Het
Flnb T C 14: 7,909,748 Y1401H probably damaging Het
Foxl2 A T 9: 98,956,055 D132V probably damaging Het
Frs2 C A 10: 117,078,842 W57C probably damaging Het
Gm26558 G T 2: 70,661,417 probably benign Het
Gpr139 A G 7: 119,144,840 V174A probably benign Het
Grik5 T C 7: 25,015,819 T676A probably damaging Het
H60c T C 10: 3,259,273 probably null Het
Hspa1l A G 17: 34,978,469 K495E probably damaging Het
Irgm1 C T 11: 48,866,217 V256I probably benign Het
Kat7 T A 11: 95,286,416 T293S probably benign Het
Lipg C T 18: 74,960,938 V13I probably benign Het
Lrrn1 A T 6: 107,569,224 Y661F probably damaging Het
Mllt3 A G 4: 87,840,995 V272A probably benign Het
Mx1 G A 16: 97,455,494 R162C probably benign Het
Myo18b T A 5: 112,871,470 D647V probably damaging Het
Naf1 G A 8: 66,879,646 V329I probably benign Het
Olfr1286 A T 2: 111,420,774 M59K probably damaging Het
Olfr654 A T 7: 104,588,211 I153F probably damaging Het
Olfr936 A T 9: 39,046,969 C194* probably null Het
P2rx5 G A 11: 73,171,790 V442M possibly damaging Het
Pcdhb9 A G 18: 37,401,232 E93G probably damaging Het
Pcdhga4 A T 18: 37,687,426 N676I probably benign Het
Pgm5 A G 19: 24,820,128 M230T probably damaging Het
Pik3c2g T C 6: 139,622,018 V44A probably damaging Het
Pp2d1 T C 17: 53,508,140 M519V probably benign Het
Ppp1r10 A G 17: 35,928,511 E404G probably damaging Het
Prpf8 A T 11: 75,489,783 E104V possibly damaging Het
Ptpa T C 2: 30,438,355 probably null Het
Pygl A C 12: 70,201,344 N248K probably damaging Het
Rbm8a A G 3: 96,630,932 D102G probably damaging Het
Sema3d A G 5: 12,584,908 D647G probably benign Het
Serpinb11 A T 1: 107,379,754 D305V probably damaging Het
Slc12a8 T C 16: 33,617,208 I337T probably damaging Het
Slc29a2 G A 19: 5,028,967 R286Q probably benign Het
Slc2a3 T A 6: 122,735,583 D234V probably damaging Het
Slco4a1 T C 2: 180,473,108 V608A probably damaging Het
Srrm2 C T 17: 23,816,587 T831I probably benign Het
St18 T A 1: 6,802,317 probably null Het
Tesk2 G C 4: 116,741,896 G67A probably damaging Het
Tlr1 A T 5: 64,925,221 L671H probably damaging Het
Tmem63b A T 17: 45,661,477 Y735N possibly damaging Het
Tmprss11a C T 5: 86,420,079 C263Y probably damaging Het
Trio A T 15: 27,897,991 V345E probably damaging Het
Ubr5 A G 15: 37,997,916 S1674P probably damaging Het
Uchl3 T A 14: 101,695,917 C209S probably damaging Het
Uhmk1 T C 1: 170,211,167 N206S probably damaging Het
Uhrf1 C T 17: 56,318,340 R588W probably damaging Het
Usp28 T C 9: 49,010,250 V256A probably damaging Het
Utrn C A 10: 12,728,777 L552F probably damaging Het
Vmn1r55 A T 7: 5,146,986 M146K probably damaging Het
Vmn1r57 A C 7: 5,221,108 I211L probably benign Het
Zar1 C T 5: 72,577,399 C316Y probably damaging Het
Zc3h11a A T 1: 133,621,674 S750T probably damaging Het
Zcchc6 A G 13: 59,816,656 probably null Het
Zfp366 G A 13: 99,246,168 C613Y probably benign Het
Zfp37 A T 4: 62,191,256 C524S probably damaging Het
Zfp516 T C 18: 82,957,093 V472A probably benign Het
Zhx1 A T 15: 58,052,423 M809K probably damaging Het
Zic1 T C 9: 91,364,371 Y216C probably damaging Het
Other mutations in Abca8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Abca8a APN 11 110050939 missense possibly damaging 0.52
IGL01099:Abca8a APN 11 110074205 splice site probably benign
IGL01100:Abca8a APN 11 110058423 critical splice donor site probably null
IGL01310:Abca8a APN 11 110059975 missense probably benign 0.02
IGL01357:Abca8a APN 11 110031572 missense probably benign 0.05
IGL01554:Abca8a APN 11 110042166 missense probably benign 0.24
IGL01937:Abca8a APN 11 110083304 splice site probably benign
IGL01945:Abca8a APN 11 110083304 splice site probably benign
IGL01987:Abca8a APN 11 110074155 missense possibly damaging 0.63
IGL02023:Abca8a APN 11 110063116 missense probably benign 0.04
IGL02208:Abca8a APN 11 110059946 missense probably damaging 1.00
IGL02378:Abca8a APN 11 110078815 unclassified probably benign
IGL02380:Abca8a APN 11 110078815 unclassified probably benign
IGL02387:Abca8a APN 11 110078815 unclassified probably benign
IGL02388:Abca8a APN 11 110078815 unclassified probably benign
IGL02524:Abca8a APN 11 110078815 unclassified probably benign
IGL02551:Abca8a APN 11 110084242 missense probably benign 0.05
IGL02831:Abca8a APN 11 110053081 missense probably damaging 1.00
IGL02836:Abca8a APN 11 110070351 missense possibly damaging 0.89
IGL02934:Abca8a APN 11 110040588 missense probably damaging 1.00
IGL02946:Abca8a APN 11 110028215 splice site probably benign
IGL02967:Abca8a APN 11 110050936 missense probably damaging 1.00
IGL02997:Abca8a APN 11 110075533 splice site probably benign
IGL03265:Abca8a APN 11 110053103 missense probably benign 0.01
G5030:Abca8a UTSW 11 110070339 missense probably damaging 1.00
H8562:Abca8a UTSW 11 110043009 missense probably benign
PIT4445001:Abca8a UTSW 11 110075551 missense probably damaging 0.99
R0060:Abca8a UTSW 11 110070480 missense probably damaging 1.00
R0060:Abca8a UTSW 11 110070480 missense probably damaging 1.00
R0084:Abca8a UTSW 11 110036597 splice site probably benign
R0394:Abca8a UTSW 11 110026343 missense probably damaging 0.99
R0477:Abca8a UTSW 11 110065225 missense probably benign
R0593:Abca8a UTSW 11 110068099 missense probably damaging 1.00
R0744:Abca8a UTSW 11 110040564 missense possibly damaging 0.91
R0764:Abca8a UTSW 11 110059946 missense probably damaging 1.00
R0787:Abca8a UTSW 11 110042988 missense possibly damaging 0.60
R0836:Abca8a UTSW 11 110040564 missense possibly damaging 0.91
R0848:Abca8a UTSW 11 110028190 missense probably damaging 1.00
R0894:Abca8a UTSW 11 110050966 missense probably benign 0.00
R1163:Abca8a UTSW 11 110071530 missense probably benign 0.01
R1224:Abca8a UTSW 11 110040582 missense probably damaging 1.00
R1474:Abca8a UTSW 11 110069809 missense probably damaging 1.00
R1596:Abca8a UTSW 11 110068060 missense possibly damaging 0.89
R1708:Abca8a UTSW 11 110053102 missense probably damaging 1.00
R1715:Abca8a UTSW 11 110091580 missense probably damaging 0.98
R1795:Abca8a UTSW 11 110050966 missense probably benign 0.00
R1832:Abca8a UTSW 11 110071451 missense probably damaging 0.99
R1852:Abca8a UTSW 11 110069386 missense probably damaging 1.00
R1887:Abca8a UTSW 11 110089942 missense probably damaging 1.00
R1891:Abca8a UTSW 11 110091607 missense probably benign 0.20
R1917:Abca8a UTSW 11 110091515 splice site probably benign
R1943:Abca8a UTSW 11 110069863 missense probably benign 0.00
R1962:Abca8a UTSW 11 110026905 critical splice acceptor site probably null
R2016:Abca8a UTSW 11 110070387 missense probably damaging 0.99
R2037:Abca8a UTSW 11 110089984 splice site probably null
R2098:Abca8a UTSW 11 110036579 missense probably damaging 1.00
R2102:Abca8a UTSW 11 110068052 missense probably damaging 1.00
R2134:Abca8a UTSW 11 110030917 missense probably null 1.00
R2220:Abca8a UTSW 11 110026855 missense probably damaging 1.00
R2269:Abca8a UTSW 11 110026892 missense probably damaging 1.00
R2395:Abca8a UTSW 11 110068788 missense probably damaging 1.00
R2847:Abca8a UTSW 11 110042105 missense probably damaging 1.00
R2849:Abca8a UTSW 11 110042105 missense probably damaging 1.00
R3508:Abca8a UTSW 11 110063165 missense probably benign
R3974:Abca8a UTSW 11 110083502 missense probably damaging 1.00
R4009:Abca8a UTSW 11 110090107 missense probably damaging 0.98
R4163:Abca8a UTSW 11 110050982 missense probably benign 0.00
R4274:Abca8a UTSW 11 110090104 missense probably damaging 0.96
R4507:Abca8a UTSW 11 110063025 missense probably benign 0.19
R4571:Abca8a UTSW 11 110030058 missense probably damaging 1.00
R4672:Abca8a UTSW 11 110071876 missense possibly damaging 0.94
R4700:Abca8a UTSW 11 110070482 missense probably damaging 1.00
R4770:Abca8a UTSW 11 110071515 missense possibly damaging 0.82
R4946:Abca8a UTSW 11 110086474 missense probably damaging 1.00
R4955:Abca8a UTSW 11 110036512 missense probably benign 0.00
R5190:Abca8a UTSW 11 110089909 critical splice donor site probably null
R5597:Abca8a UTSW 11 110036537 missense probably damaging 1.00
R5677:Abca8a UTSW 11 110038399 missense possibly damaging 0.51
R5757:Abca8a UTSW 11 110042968 missense probably benign 0.28
R5822:Abca8a UTSW 11 110030879 missense probably damaging 0.98
R5925:Abca8a UTSW 11 110057223 missense probably damaging 1.00
R6090:Abca8a UTSW 11 110063222 critical splice acceptor site probably null
R6122:Abca8a UTSW 11 110070423 missense probably benign 0.40
R6189:Abca8a UTSW 11 110030884 missense probably damaging 1.00
R6200:Abca8a UTSW 11 110090050 missense probably damaging 0.98
R6374:Abca8a UTSW 11 110083390 nonsense probably null
R7022:Abca8a UTSW 11 110083500 missense probably damaging 1.00
R7161:Abca8a UTSW 11 110074142 missense probably benign 0.09
R7198:Abca8a UTSW 11 110078655 missense probably damaging 1.00
R7220:Abca8a UTSW 11 110089967 missense probably benign 0.00
R7290:Abca8a UTSW 11 110030888 missense probably benign 0.03
R7381:Abca8a UTSW 11 110030087 splice site probably null
R7437:Abca8a UTSW 11 110050964 missense probably benign
R7733:Abca8a UTSW 11 110054587 missense probably benign 0.02
R7785:Abca8a UTSW 11 110074206 splice site probably null
R7917:Abca8a UTSW 11 110068107 missense probably damaging 1.00
R7948:Abca8a UTSW 11 110050979 missense probably benign
R7957:Abca8a UTSW 11 110091613 start codon destroyed probably null 1.00
R7958:Abca8a UTSW 11 110031672 missense probably damaging 1.00
R7981:Abca8a UTSW 11 110089913 missense probably benign 0.00
R8033:Abca8a UTSW 11 110036522 missense probably damaging 1.00
R8069:Abca8a UTSW 11 110090050 missense probably damaging 0.98
R8116:Abca8a UTSW 11 110091594 missense probably benign 0.27
R8289:Abca8a UTSW 11 110036689 intron probably benign
R8334:Abca8a UTSW 11 110068824 missense probably damaging 1.00
R8371:Abca8a UTSW 11 110054647 missense probably benign 0.31
R8406:Abca8a UTSW 11 110086517 missense probably damaging 1.00
R8438:Abca8a UTSW 11 110075578 missense probably damaging 1.00
R8670:Abca8a UTSW 11 110075598 missense probably damaging 1.00
R8807:Abca8a UTSW 11 110083426 missense probably benign 0.35
R8821:Abca8a UTSW 11 110058536 missense probably damaging 0.98
R8838:Abca8a UTSW 11 110030055 missense probably damaging 1.00
R8884:Abca8a UTSW 11 110074115 missense possibly damaging 0.60
R8885:Abca8a UTSW 11 110069479 missense probably damaging 1.00
R8962:Abca8a UTSW 11 110078808 missense probably damaging 1.00
R8966:Abca8a UTSW 11 110071419 critical splice donor site probably null
R9272:Abca8a UTSW 11 110063082 missense probably damaging 0.99
R9331:Abca8a UTSW 11 110026328 missense probably damaging 1.00
R9397:Abca8a UTSW 11 110030347 missense probably damaging 1.00
R9498:Abca8a UTSW 11 110086548 missense probably damaging 0.99
R9529:Abca8a UTSW 11 110056341 nonsense probably null
X0022:Abca8a UTSW 11 110031097 missense probably damaging 1.00
X0024:Abca8a UTSW 11 110083335 missense probably damaging 1.00
X0053:Abca8a UTSW 11 110083484 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTGGAGCCATGATTTTCTTCCC -3'
(R):5'- TACACTGTTGAAGAAGTCTGAGAGTG -3'

Sequencing Primer
(F):5'- TCCCAGCGGTGTCTCTAG -3'
(R):5'- TGTTGAAGAAGTCTGAGAGTGAGAAG -3'
Posted On 2016-07-06