Mutagenetix > Incidental Mutation

Incidental Mutation 'R5186:Pygl'

397903

Institutional Source

Beutler Lab

Gene Symbol

Pygl

Ensembl Gene

ENSMUSG00000021069

Gene Name

liver glycogen phosphorylase

Synonyms

MMRRC Submission

042765-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.384) question?

Stock #

R5186 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

70190811-70231488 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 70201344 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 248 (N248K)

Ref Sequence

ENSEMBL: ENSMUSP00000125585 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071250] [ENSMUST00000161083]

AlphaFold

Q9ET01

Predicted Effect

probably damaging
Transcript: ENSMUST00000071250
AA Change: N339K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000071231
Gene: ENSMUSG00000021069
AA Change: N339K

Domain	Start	End	E-Value	Type
Pfam:Phosphorylase	113	829	N/A	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000161083
AA Change: N248K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125585
Gene: ENSMUSG00000021069
AA Change: N248K

Domain	Start	End	E-Value	Type
Pfam:Phosphorylase	21	739	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162613

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222093

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homodimeric protein that catalyses the cleavage of alpha-1,4-glucosidic bonds to release glucose-1-phosphate from liver glycogen stores. This protein switches from inactive phosphorylase B to active phosphorylase A by phosphorylation of serine residue 15. Activity of this enzyme is further regulated by multiple allosteric effectors and hormonal controls. Humans have three glycogen phosphorylase genes that encode distinct isozymes that are primarily expressed in liver, brain and muscle, respectively. The liver isozyme serves the glycemic demands of the body in general while the brain and muscle isozymes supply just those tissues. In glycogen storage disease type VI, also known as Hers disease, mutations in liver glycogen phosphorylase inhibit the conversion of glycogen to glucose and results in moderate hypoglycemia, mild ketosis, growth retardation and hepatomegaly. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Feb 2011]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	T	13: 59,743,739	L89H	probably damaging	Het
Abca8a	T	C	11: 110,091,599	I6V	probably null	Het
Aox1	A	G	1: 58,068,370	D601G	probably damaging	Het
Asic1	GCACC	GCACCACC	15: 99,698,803		probably benign	Het
Cacna1g	T	G	11: 94,442,848	N931T	probably damaging	Het
Ccdc14	T	C	16: 34,721,585	F511L	probably damaging	Het
Cd177	T	A	7: 24,744,923	E710V	probably benign	Het
Cep112	T	C	11: 108,752,560	C49R	probably benign	Het
Clip2	G	A	5: 134,522,791	T159M	possibly damaging	Het
Dnah2	T	C	11: 69,435,884	N3575S	probably damaging	Het
Dnah6	T	A	6: 73,067,427	I3234F	probably damaging	Het
Eci3	G	T	13: 34,946,978	A302E	possibly damaging	Het
Fam204a	T	C	19: 60,199,989	K214E	probably damaging	Het
Fam78a	T	C	2: 32,082,654	T85A	possibly damaging	Het
Flnb	T	C	14: 7,909,748	Y1401H	probably damaging	Het
Foxl2	A	T	9: 98,956,055	D132V	probably damaging	Het
Frs2	C	A	10: 117,078,842	W57C	probably damaging	Het
Gm26558	G	T	2: 70,661,417		probably benign	Het
Gpr139	A	G	7: 119,144,840	V174A	probably benign	Het
Grik5	T	C	7: 25,015,819	T676A	probably damaging	Het
H60c	T	C	10: 3,259,273		probably null	Het
Hspa1l	A	G	17: 34,978,469	K495E	probably damaging	Het
Irgm1	C	T	11: 48,866,217	V256I	probably benign	Het
Kat7	T	A	11: 95,286,416	T293S	probably benign	Het
Lipg	C	T	18: 74,960,938	V13I	probably benign	Het
Lrrn1	A	T	6: 107,569,224	Y661F	probably damaging	Het
Mllt3	A	G	4: 87,840,995	V272A	probably benign	Het
Mx1	G	A	16: 97,455,494	R162C	probably benign	Het
Myo18b	T	A	5: 112,871,470	D647V	probably damaging	Het
Naf1	G	A	8: 66,879,646	V329I	probably benign	Het
Olfr1286	A	T	2: 111,420,774	M59K	probably damaging	Het
Olfr654	A	T	7: 104,588,211	I153F	probably damaging	Het
Olfr936	A	T	9: 39,046,969	C194*	probably null	Het
P2rx5	G	A	11: 73,171,790	V442M	possibly damaging	Het
Pcdhb9	A	G	18: 37,401,232	E93G	probably damaging	Het
Pcdhga4	A	T	18: 37,687,426	N676I	probably benign	Het
Pgm5	A	G	19: 24,820,128	M230T	probably damaging	Het
Pik3c2g	T	C	6: 139,622,018	V44A	probably damaging	Het
Pp2d1	T	C	17: 53,508,140	M519V	probably benign	Het
Ppp1r10	A	G	17: 35,928,511	E404G	probably damaging	Het
Prpf8	A	T	11: 75,489,783	E104V	possibly damaging	Het
Ptpa	T	C	2: 30,438,355		probably null	Het
Rbm8a	A	G	3: 96,630,932	D102G	probably damaging	Het
Sema3d	A	G	5: 12,584,908	D647G	probably benign	Het
Serpinb11	A	T	1: 107,379,754	D305V	probably damaging	Het
Slc12a8	T	C	16: 33,617,208	I337T	probably damaging	Het
Slc29a2	G	A	19: 5,028,967	R286Q	probably benign	Het
Slc2a3	T	A	6: 122,735,583	D234V	probably damaging	Het
Slco4a1	T	C	2: 180,473,108	V608A	probably damaging	Het
Srrm2	C	T	17: 23,816,587	T831I	probably benign	Het
St18	T	A	1: 6,802,317		probably null	Het
Tesk2	G	C	4: 116,741,896	G67A	probably damaging	Het
Tlr1	A	T	5: 64,925,221	L671H	probably damaging	Het
Tmem63b	A	T	17: 45,661,477	Y735N	possibly damaging	Het
Tmprss11a	C	T	5: 86,420,079	C263Y	probably damaging	Het
Trio	A	T	15: 27,897,991	V345E	probably damaging	Het
Ubr5	A	G	15: 37,997,916	S1674P	probably damaging	Het
Uchl3	T	A	14: 101,695,917	C209S	probably damaging	Het
Uhmk1	T	C	1: 170,211,167	N206S	probably damaging	Het
Uhrf1	C	T	17: 56,318,340	R588W	probably damaging	Het
Usp28	T	C	9: 49,010,250	V256A	probably damaging	Het
Utrn	C	A	10: 12,728,777	L552F	probably damaging	Het
Vmn1r55	A	T	7: 5,146,986	M146K	probably damaging	Het
Vmn1r57	A	C	7: 5,221,108	I211L	probably benign	Het
Zar1	C	T	5: 72,577,399	C316Y	probably damaging	Het
Zc3h11a	A	T	1: 133,621,674	S750T	probably damaging	Het
Zcchc6	A	G	13: 59,816,656		probably null	Het
Zfp366	G	A	13: 99,246,168	C613Y	probably benign	Het
Zfp37	A	T	4: 62,191,256	C524S	probably damaging	Het
Zfp516	T	C	18: 82,957,093	V472A	probably benign	Het
Zhx1	A	T	15: 58,052,423	M809K	probably damaging	Het
Zic1	T	C	9: 91,364,371	Y216C	probably damaging	Het

Other mutations in Pygl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Pygl	APN	12	70191092	missense	probably damaging	1.00
IGL00903:Pygl	APN	12	70207742	missense	probably damaging	1.00
IGL01965:Pygl	APN	12	70191114	missense	probably benign	0.00
IGL02347:Pygl	APN	12	70201892	missense	probably benign	0.14
IGL02403:Pygl	APN	12	70194258	missense	probably benign
IGL02501:Pygl	APN	12	70191134	missense	probably benign	0.05
IGL02727:Pygl	APN	12	70207668	splice site	probably null
IGL03125:Pygl	APN	12	70197482	missense	probably damaging	1.00
IGL03158:Pygl	APN	12	70195675	missense	probably damaging	1.00
IGL03202:Pygl	APN	12	70199646	missense	probably benign
IGL03368:Pygl	APN	12	70191152	missense	probably benign
R0096:Pygl	UTSW	12	70191166	splice site	probably benign
R0096:Pygl	UTSW	12	70191166	splice site	probably benign
R0524:Pygl	UTSW	12	70207724	missense	probably damaging	1.00
R0883:Pygl	UTSW	12	70206404	missense	probably damaging	0.97
R0894:Pygl	UTSW	12	70194374	splice site	probably benign
R0905:Pygl	UTSW	12	70211017	splice site	probably benign
R1494:Pygl	UTSW	12	70199730	missense	probably damaging	0.98
R1621:Pygl	UTSW	12	70191092	missense	probably damaging	1.00
R1647:Pygl	UTSW	12	70197010	missense	possibly damaging	0.60
R3082:Pygl	UTSW	12	70197529	missense	probably damaging	1.00
R3845:Pygl	UTSW	12	70198443	missense	probably benign	0.12
R3876:Pygl	UTSW	12	70201339	missense	probably damaging	1.00
R4358:Pygl	UTSW	12	70195690	missense	probably damaging	1.00
R4614:Pygl	UTSW	12	70210979	splice site	probably null
R4707:Pygl	UTSW	12	70207758	missense	possibly damaging	0.69
R4908:Pygl	UTSW	12	70197033	missense	probably null
R4940:Pygl	UTSW	12	70206381	missense	probably damaging	1.00
R5077:Pygl	UTSW	12	70201892	missense	probably benign	0.14
R5726:Pygl	UTSW	12	70191142	nonsense	probably null
R5953:Pygl	UTSW	12	70219627	missense	probably damaging	1.00
R5957:Pygl	UTSW	12	70199720	missense	probably damaging	0.99
R6020:Pygl	UTSW	12	70216654	missense	probably damaging	1.00
R6024:Pygl	UTSW	12	70197067	missense	probably benign	0.09
R7050:Pygl	UTSW	12	70219622	missense	probably damaging	1.00
R7159:Pygl	UTSW	12	70197406	missense	probably benign	0.41
R7194:Pygl	UTSW	12	70194320	missense	probably benign
R7283:Pygl	UTSW	12	70216568	missense	possibly damaging	0.92
R7360:Pygl	UTSW	12	70227532	missense	probably benign	0.11
R7446:Pygl	UTSW	12	70197010	missense	probably benign
R7637:Pygl	UTSW	12	70197795	splice site	probably null
R7886:Pygl	UTSW	12	70206356	splice site	probably null
R8054:Pygl	UTSW	12	70227339	critical splice donor site	probably null
R8693:Pygl	UTSW	12	70197406	missense	probably benign	0.41
R8753:Pygl	UTSW	12	70195626	missense	probably damaging	1.00
R8803:Pygl	UTSW	12	70195616	missense	probably damaging	1.00
R8842:Pygl	UTSW	12	70227594	intron	probably benign
R9192:Pygl	UTSW	12	70197048	missense	probably damaging	0.99
R9221:Pygl	UTSW	12	70195627	missense	probably damaging	1.00
R9437:Pygl	UTSW	12	70200151	missense	probably damaging	1.00
R9750:Pygl	UTSW	12	70198529	missense	possibly damaging	0.68
Z1176:Pygl	UTSW	12	70222874	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- GAAATATGTTGGCATCAGGGC -3'
(R):5'- AAGATTGCCATCAGATTCACTCTCTC -3'

Sequencing Primer
(F):5'- GCAAGCTATACCTTCAACTGTGGG -3'
(R):5'- TCCCTGTGCTCAGAAAGTTAGAC -3'

Posted On

2016-07-06