Mutagenetix > Incidental Mutations

Incidental Mutation 'R5186:Trio'

397910

Institutional Source

Beutler Lab

Gene Symbol

Trio

Ensembl Gene

ENSMUSG00000022263

Gene Name

triple functional domain (PTPRF interacting)

Synonyms

Solo, 6720464I07Rik

MMRRC Submission

042765-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5186 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

27730651-28025848 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 27897991 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 345 (V345E)

Ref Sequence

ENSEMBL: ENSMUSP00000154653 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090247] [ENSMUST00000226775] [ENSMUST00000227337]

Predicted Effect

unknown
Transcript: ENSMUST00000090247
AA Change: V404E

SMART Domains

Protein: ENSMUSP00000087714
Gene: ENSMUSG00000022263
AA Change: V404E

Domain	Start	End	E-Value	Type
low complexity region	2	40	N/A	INTRINSIC
SEC14	68	207	3.4e-26	SMART
SPEC	221	337	2.48e-9	SMART
SPEC	343	445	1.92e-15	SMART
SPEC	569	671	5.35e-14	SMART
SPEC	674	783	1.18e-6	SMART
SPEC	910	1011	2.6e-12	SMART
SPEC	1141	1243	7e-18	SMART
low complexity region	1249	1258	N/A	INTRINSIC
RhoGEF	1296	1466	2.79e-53	SMART
PH	1480	1593	1.53e-9	SMART
SH3	1659	1720	1.9e-8	SMART
low complexity region	1788	1802	N/A	INTRINSIC
low complexity region	1837	1863	N/A	INTRINSIC
low complexity region	1936	1954	N/A	INTRINSIC
RhoGEF	1973	2144	1.32e-63	SMART
PH	2158	2273	3.6e-6	SMART
low complexity region	2291	2341	N/A	INTRINSIC
low complexity region	2371	2390	N/A	INTRINSIC
low complexity region	2491	2503	N/A	INTRINSIC
SH3	2558	2619	1.04e0	SMART
low complexity region	2640	2660	N/A	INTRINSIC
IGc2	2701	2770	4e-12	SMART
S_TKc	2800	3054	4.84e-72	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000226775

Predicted Effect

probably damaging
Transcript: ENSMUST00000227337
AA Change: V345E

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that functions as a GDP to GTP exchange factor. This protein promotes the reorganization of the actin cytoskeleton, thereby playing a role in cell migration and growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant mice die during late embryonic development or shortly after birth. They exhibit abnormal skeletal myogenesis and display aberrant organization within the hippocampus and olfactory bulb. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	T	13: 59,743,739	L89H	probably damaging	Het
Abca8a	T	C	11: 110,091,599	I6V	probably null	Het
Aox1	A	G	1: 58,068,370	D601G	probably damaging	Het
Asic1	GCACC	GCACCACC	15: 99,698,803		probably benign	Het
Cacna1g	T	G	11: 94,442,848	N931T	probably damaging	Het
Ccdc14	T	C	16: 34,721,585	F511L	probably damaging	Het
Cd177	T	A	7: 24,744,923	E710V	probably benign	Het
Cep112	T	C	11: 108,752,560	C49R	probably benign	Het
Clip2	G	A	5: 134,522,791	T159M	possibly damaging	Het
Dnah2	T	C	11: 69,435,884	N3575S	probably damaging	Het
Dnah6	T	A	6: 73,067,427	I3234F	probably damaging	Het
Eci3	G	T	13: 34,946,978	A302E	possibly damaging	Het
Fam204a	T	C	19: 60,199,989	K214E	probably damaging	Het
Fam78a	T	C	2: 32,082,654	T85A	possibly damaging	Het
Flnb	T	C	14: 7,909,748	Y1401H	probably damaging	Het
Foxl2	A	T	9: 98,956,055	D132V	probably damaging	Het
Frs2	C	A	10: 117,078,842	W57C	probably damaging	Het
Gm26558	G	T	2: 70,661,417		probably benign	Het
Gpr139	A	G	7: 119,144,840	V174A	probably benign	Het
Grik5	T	C	7: 25,015,819	T676A	probably damaging	Het
H60c	T	C	10: 3,259,273		probably null	Het
Hspa1l	A	G	17: 34,978,469	K495E	probably damaging	Het
Irgm1	C	T	11: 48,866,217	V256I	probably benign	Het
Kat7	T	A	11: 95,286,416	T293S	probably benign	Het
Lipg	C	T	18: 74,960,938	V13I	probably benign	Het
Lrrn1	A	T	6: 107,569,224	Y661F	probably damaging	Het
Mllt3	A	G	4: 87,840,995	V272A	probably benign	Het
Mx1	G	A	16: 97,455,494	R162C	probably benign	Het
Myo18b	T	A	5: 112,871,470	D647V	probably damaging	Het
Naf1	G	A	8: 66,879,646	V329I	probably benign	Het
Olfr1286	A	T	2: 111,420,774	M59K	probably damaging	Het
Olfr654	A	T	7: 104,588,211	I153F	probably damaging	Het
Olfr936	A	T	9: 39,046,969	C194*	probably null	Het
P2rx5	G	A	11: 73,171,790	V442M	possibly damaging	Het
Pcdhb9	A	G	18: 37,401,232	E93G	probably damaging	Het
Pcdhga4	A	T	18: 37,687,426	N676I	probably benign	Het
Pgm5	A	G	19: 24,820,128	M230T	probably damaging	Het
Pik3c2g	T	C	6: 139,622,018	V44A	probably damaging	Het
Pp2d1	T	C	17: 53,508,140	M519V	probably benign	Het
Ppp1r10	A	G	17: 35,928,511	E404G	probably damaging	Het
Prpf8	A	T	11: 75,489,783	E104V	possibly damaging	Het
Ptpa	T	C	2: 30,438,355		probably null	Het
Pygl	A	C	12: 70,201,344	N248K	probably damaging	Het
Rbm8a	A	G	3: 96,630,932	D102G	probably damaging	Het
Sema3d	A	G	5: 12,584,908	D647G	probably benign	Het
Serpinb11	A	T	1: 107,379,754	D305V	probably damaging	Het
Slc12a8	T	C	16: 33,617,208	I337T	probably damaging	Het
Slc29a2	G	A	19: 5,028,967	R286Q	probably benign	Het
Slc2a3	T	A	6: 122,735,583	D234V	probably damaging	Het
Slco4a1	T	C	2: 180,473,108	V608A	probably damaging	Het
Srrm2	C	T	17: 23,816,587	T831I	probably benign	Het
St18	T	A	1: 6,802,317		probably null	Het
Tesk2	G	C	4: 116,741,896	G67A	probably damaging	Het
Tlr1	A	T	5: 64,925,221	L671H	probably damaging	Het
Tmem63b	A	T	17: 45,661,477	Y735N	possibly damaging	Het
Tmprss11a	C	T	5: 86,420,079	C263Y	probably damaging	Het
Ubr5	A	G	15: 37,997,916	S1674P	probably damaging	Het
Uchl3	T	A	14: 101,695,917	C209S	probably damaging	Het
Uhmk1	T	C	1: 170,211,167	N206S	probably damaging	Het
Uhrf1	C	T	17: 56,318,340	R588W	probably damaging	Het
Usp28	T	C	9: 49,010,250	V256A	probably damaging	Het
Utrn	C	A	10: 12,728,777	L552F	probably damaging	Het
Vmn1r55	A	T	7: 5,146,986	M146K	probably damaging	Het
Vmn1r57	A	C	7: 5,221,108	I211L	probably benign	Het
Zar1	C	T	5: 72,577,399	C316Y	probably damaging	Het
Zc3h11a	A	T	1: 133,621,674	S750T	probably damaging	Het
Zcchc6	A	G	13: 59,816,656		probably null	Het
Zfp366	G	A	13: 99,246,168	C613Y	probably benign	Het
Zfp37	A	T	4: 62,191,256	C524S	probably damaging	Het
Zfp516	T	C	18: 82,957,093	V472A	probably benign	Het
Zhx1	A	T	15: 58,052,423	M809K	probably damaging	Het
Zic1	T	C	9: 91,364,371	Y216C	probably damaging	Het

Other mutations in Trio

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00480:Trio	APN	15	27912743	splice site	probably benign
IGL01011:Trio	APN	15	27736489	missense	probably damaging	0.96
IGL01090:Trio	APN	15	27773007	missense	probably damaging	1.00
IGL01145:Trio	APN	15	27818167	splice site	probably benign
IGL01147:Trio	APN	15	27881320	missense	probably damaging	1.00
IGL01161:Trio	APN	15	27749781	missense	probably damaging	1.00
IGL01324:Trio	APN	15	27905323	missense	probably benign	0.42
IGL01352:Trio	APN	15	27901229	missense	probably benign	0.01
IGL01366:Trio	APN	15	27732868	missense	possibly damaging	0.76
IGL01443:Trio	APN	15	27838775	splice site	probably benign
IGL01454:Trio	APN	15	27832985	missense	probably benign	0.32
IGL01695:Trio	APN	15	27773001	missense	probably damaging	1.00
IGL01765:Trio	APN	15	27764026	missense	possibly damaging	0.85
IGL01860:Trio	APN	15	27846810	missense	probably damaging	1.00
IGL01879:Trio	APN	15	27741033	missense	probably benign	0.12
IGL01991:Trio	APN	15	27871274	missense	possibly damaging	0.95
IGL02106:Trio	APN	15	27744158	missense	possibly damaging	0.85
IGL02209:Trio	APN	15	27744053	missense	probably damaging	1.00
IGL02232:Trio	APN	15	27902561	missense	probably benign	0.24
IGL02304:Trio	APN	15	27735436	missense	probably damaging	0.96
IGL02504:Trio	APN	15	27847390	nonsense	probably null
IGL02508:Trio	APN	15	27818104	missense	possibly damaging	0.65
IGL02541:Trio	APN	15	27844930	splice site	probably benign
IGL02617:Trio	APN	15	27841849	splice site	probably benign
IGL02675:Trio	APN	15	27768039	unclassified	probably benign
IGL02817:Trio	APN	15	27902881	missense	probably benign	0.01
IGL02993:Trio	APN	15	27830239	splice site	probably benign
IGL03007:Trio	APN	15	27902742	missense	probably damaging	0.99
IGL03135:Trio	APN	15	27832011	splice site	probably benign
IGL03225:Trio	APN	15	27902695	missense	probably benign	0.30
R0063:Trio	UTSW	15	27881437	splice site	probably benign
R0063:Trio	UTSW	15	27881437	splice site	probably benign
R0302:Trio	UTSW	15	27902517	missense	probably damaging	1.00
R0505:Trio	UTSW	15	27767907	missense	probably benign	0.00
R0506:Trio	UTSW	15	27854963	missense	probably benign	0.12
R0564:Trio	UTSW	15	27805822	missense	probably damaging	1.00
R0659:Trio	UTSW	15	27831399	missense	probably damaging	0.97
R0882:Trio	UTSW	15	27732894	missense	probably damaging	1.00
R0939:Trio	UTSW	15	27741250	critical splice donor site	probably null
R1018:Trio	UTSW	15	27871171	missense	probably damaging	1.00
R1439:Trio	UTSW	15	27897914	missense	probably damaging	1.00
R1456:Trio	UTSW	15	27753804	splice site	probably benign
R1488:Trio	UTSW	15	27740967	missense	probably damaging	1.00
R1522:Trio	UTSW	15	27732640	missense	probably benign	0.28
R1531:Trio	UTSW	15	27832985	missense	probably benign	0.32
R1640:Trio	UTSW	15	27833044	missense	probably damaging	1.00
R1646:Trio	UTSW	15	27758347	missense	possibly damaging	0.91
R1682:Trio	UTSW	15	27744146	splice site	probably null
R1780:Trio	UTSW	15	27744038	missense	possibly damaging	0.93
R1791:Trio	UTSW	15	27841756	missense	probably damaging	1.00
R1803:Trio	UTSW	15	27748340	missense	probably benign
R1817:Trio	UTSW	15	27742495	nonsense	probably null
R1853:Trio	UTSW	15	27756536	missense	probably damaging	1.00
R1898:Trio	UTSW	15	27742380	missense	possibly damaging	0.52
R1937:Trio	UTSW	15	27833056	missense	probably damaging	1.00
R1938:Trio	UTSW	15	27732891	missense	probably damaging	0.98
R2025:Trio	UTSW	15	27744137	missense	probably damaging	0.99
R2025:Trio	UTSW	15	27773927	missense	probably damaging	1.00
R2050:Trio	UTSW	15	27851945	missense	possibly damaging	0.85
R2186:Trio	UTSW	15	27823975	splice site	probably null
R2913:Trio	UTSW	15	27854912	missense	probably damaging	1.00
R3151:Trio	UTSW	15	27805776	missense	probably damaging	1.00
R3771:Trio	UTSW	15	27748091	missense	probably damaging	0.98
R3773:Trio	UTSW	15	27748091	missense	probably damaging	0.98
R3826:Trio	UTSW	15	27833070	missense	probably damaging	1.00
R4015:Trio	UTSW	15	27744101	missense	possibly damaging	0.71
R4359:Trio	UTSW	15	27749797	nonsense	probably null
R4370:Trio	UTSW	15	27748337	nonsense	probably null
R4547:Trio	UTSW	15	27818982	missense	possibly damaging	0.89
R4573:Trio	UTSW	15	27772998	small deletion	probably benign
R4620:Trio	UTSW	15	27871171	missense	probably damaging	1.00
R4735:Trio	UTSW	15	27752789	splice site	probably null
R4764:Trio	UTSW	15	27732538	nonsense	probably null
R4775:Trio	UTSW	15	27881342	nonsense	probably null
R4942:Trio	UTSW	15	27752725	missense	probably benign	0.21
R5004:Trio	UTSW	15	27755178	missense	probably damaging	1.00
R5149:Trio	UTSW	15	27754029	missense	possibly damaging	0.74
R5183:Trio	UTSW	15	27902600	missense	probably benign	0.00
R5268:Trio	UTSW	15	27748286	missense	probably benign	0.02
R5344:Trio	UTSW	15	27735532	missense	probably benign	0.12
R5407:Trio	UTSW	15	27844806	splice site	probably null
R5442:Trio	UTSW	15	27856194	missense	probably benign	0.04
R5617:Trio	UTSW	15	27902748	missense	probably benign
R5778:Trio	UTSW	15	27856164	missense	probably benign	0.33
R5986:Trio	UTSW	15	27851933	missense	possibly damaging	0.88
R5990:Trio	UTSW	15	27891459	missense	probably benign	0.10
R6011:Trio	UTSW	15	27735545	missense	probably damaging	0.98
R6063:Trio	UTSW	15	27891379	missense	possibly damaging	0.94
R6166:Trio	UTSW	15	27818071	missense	probably damaging	0.96
R6187:Trio	UTSW	15	27743952	critical splice donor site	probably null
R6387:Trio	UTSW	15	27752739	missense	probably damaging	1.00
R6402:Trio	UTSW	15	27902911	missense	probably benign	0.02
R6478:Trio	UTSW	15	27856107	missense	probably benign	0.01
R6528:Trio	UTSW	15	27805870	missense	probably damaging	1.00
R6662:Trio	UTSW	15	27854996	missense	probably benign	0.00
R6825:Trio	UTSW	15	27889308	missense	probably damaging	0.98
R6890:Trio	UTSW	15	27919288	unclassified	probably benign
R6945:Trio	UTSW	15	27824090	missense	probably damaging	1.00
R7027:Trio	UTSW	15	27805654	missense	possibly damaging	0.86
R7046:Trio	UTSW	15	27832051	missense	probably damaging	1.00
R7049:Trio	UTSW	15	27749799	missense	possibly damaging	0.66
R7075:Trio	UTSW	15	27898000	missense	unknown
R7094:Trio	UTSW	15	27891448	missense	unknown
R7123:Trio	UTSW	15	27742313	critical splice donor site	probably benign
R7130:Trio	UTSW	15	27742313	critical splice donor site	probably benign
R7214:Trio	UTSW	15	27871187	missense	probably damaging	0.97
R7292:Trio	UTSW	15	27828351	missense	possibly damaging	0.63
R7293:Trio	UTSW	15	27871289	missense	possibly damaging	0.66
R7352:Trio	UTSW	15	27732876	missense	probably damaging	0.96
R7426:Trio	UTSW	15	27856107	missense	probably benign	0.01
R7451:Trio	UTSW	15	27747913	missense	probably benign	0.07
R7558:Trio	UTSW	15	27831394	missense	possibly damaging	0.90
R7578:Trio	UTSW	15	27854939	missense	possibly damaging	0.94
R7596:Trio	UTSW	15	27749826	missense	probably damaging	0.99
R7604:Trio	UTSW	15	27736445	critical splice donor site	probably null
R7609:Trio	UTSW	15	27912642	missense	unknown
R7767:Trio	UTSW	15	27889418	missense	unknown
R7784:Trio	UTSW	15	27763994	missense	probably damaging	1.00
R7817:Trio	UTSW	15	27749866	missense	probably benign	0.35
R7833:Trio	UTSW	15	27774086	missense	probably damaging	0.99
R7873:Trio	UTSW	15	27805684	missense	possibly damaging	0.83
R7879:Trio	UTSW	15	27851924	missense	possibly damaging	0.94
R7989:Trio	UTSW	15	27772935	missense	probably damaging	0.97
R8022:Trio	UTSW	15	27749866	missense	probably benign	0.35
R8050:Trio	UTSW	15	27891454	missense	unknown
R8217:Trio	UTSW	15	27818969	missense	probably damaging	0.97
R8280:Trio	UTSW	15	27902910	missense	unknown
R8283:Trio	UTSW	15	27756542	missense	possibly damaging	0.79
R8300:Trio	UTSW	15	27855022	missense	possibly damaging	0.66
R8321:Trio	UTSW	15	27881326	missense	possibly damaging	0.90
X0024:Trio	UTSW	15	27765726	missense	possibly damaging	0.91
Z1176:Trio	UTSW	15	27771387	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTTACACAAGATGGCAGGGG -3'
(R):5'- CTTGACATAGGTACCAGGTGG -3'

Sequencing Primer
(F):5'- GGCACGGGATCTGGCTC -3'
(R):5'- TGGTGCTGCTCGTAGCC -3'

Posted On

2016-07-06