Incidental Mutation 'R5186:Hspa1l'
ID397919
Institutional Source Beutler Lab
Gene Symbol Hspa1l
Ensembl Gene ENSMUSG00000007033
Gene Nameheat shock protein 1-like
Synonyms70kDa, Msh5, Hsc70t
MMRRC Submission 042765-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.603) question?
Stock #R5186 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location34972703-34979285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34978469 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 495 (K495E)
Ref Sequence ENSEMBL: ENSMUSP00000007248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007248] [ENSMUST00000007266] [ENSMUST00000114011] [ENSMUST00000173004]
Predicted Effect probably damaging
Transcript: ENSMUST00000007248
AA Change: K495E

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000007248
Gene: ENSMUSG00000007033
AA Change: K495E

DomainStartEndE-ValueType
Pfam:HSP70 8 614 6.5e-269 PFAM
low complexity region 616 629 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000007266
SMART Domains Protein: ENSMUSP00000007266
Gene: ENSMUSG00000007050

DomainStartEndE-ValueType
Sm 41 108 8.91e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114011
SMART Domains Protein: ENSMUSP00000109644
Gene: ENSMUSG00000007050

DomainStartEndE-ValueType
Sm 5 72 8.91e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172890
Predicted Effect probably benign
Transcript: ENSMUST00000173004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174241
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174326
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174860
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 70kDa heat shock protein. In conjunction with other heat shock proteins, this protein stabilizes existing proteins against aggregation and mediates the folding of newly translated proteins in the cytosol and in organelles. The gene is located in the major histocompatibility complex class III region, in a cluster with two closely related genes which also encode isoforms of the 70kDa heat shock protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,743,739 L89H probably damaging Het
Abca8a T C 11: 110,091,599 I6V probably null Het
Aox1 A G 1: 58,068,370 D601G probably damaging Het
Asic1 GCACC GCACCACC 15: 99,698,803 probably benign Het
Cacna1g T G 11: 94,442,848 N931T probably damaging Het
Ccdc14 T C 16: 34,721,585 F511L probably damaging Het
Cd177 T A 7: 24,744,923 E710V probably benign Het
Cep112 T C 11: 108,752,560 C49R probably benign Het
Clip2 G A 5: 134,522,791 T159M possibly damaging Het
Dnah2 T C 11: 69,435,884 N3575S probably damaging Het
Dnah6 T A 6: 73,067,427 I3234F probably damaging Het
Eci3 G T 13: 34,946,978 A302E possibly damaging Het
Fam204a T C 19: 60,199,989 K214E probably damaging Het
Fam78a T C 2: 32,082,654 T85A possibly damaging Het
Flnb T C 14: 7,909,748 Y1401H probably damaging Het
Foxl2 A T 9: 98,956,055 D132V probably damaging Het
Frs2 C A 10: 117,078,842 W57C probably damaging Het
Gm26558 G T 2: 70,661,417 probably benign Het
Gpr139 A G 7: 119,144,840 V174A probably benign Het
Grik5 T C 7: 25,015,819 T676A probably damaging Het
H60c T C 10: 3,259,273 probably null Het
Irgm1 C T 11: 48,866,217 V256I probably benign Het
Kat7 T A 11: 95,286,416 T293S probably benign Het
Lipg C T 18: 74,960,938 V13I probably benign Het
Lrrn1 A T 6: 107,569,224 Y661F probably damaging Het
Mllt3 A G 4: 87,840,995 V272A probably benign Het
Mx1 G A 16: 97,455,494 R162C probably benign Het
Myo18b T A 5: 112,871,470 D647V probably damaging Het
Naf1 G A 8: 66,879,646 V329I probably benign Het
Olfr1286 A T 2: 111,420,774 M59K probably damaging Het
Olfr654 A T 7: 104,588,211 I153F probably damaging Het
Olfr936 A T 9: 39,046,969 C194* probably null Het
P2rx5 G A 11: 73,171,790 V442M possibly damaging Het
Pcdhb9 A G 18: 37,401,232 E93G probably damaging Het
Pcdhga4 A T 18: 37,687,426 N676I probably benign Het
Pgm5 A G 19: 24,820,128 M230T probably damaging Het
Pik3c2g T C 6: 139,622,018 V44A probably damaging Het
Pp2d1 T C 17: 53,508,140 M519V probably benign Het
Ppp1r10 A G 17: 35,928,511 E404G probably damaging Het
Prpf8 A T 11: 75,489,783 E104V possibly damaging Het
Ptpa T C 2: 30,438,355 probably null Het
Pygl A C 12: 70,201,344 N248K probably damaging Het
Rbm8a A G 3: 96,630,932 D102G probably damaging Het
Sema3d A G 5: 12,584,908 D647G probably benign Het
Serpinb11 A T 1: 107,379,754 D305V probably damaging Het
Slc12a8 T C 16: 33,617,208 I337T probably damaging Het
Slc29a2 G A 19: 5,028,967 R286Q probably benign Het
Slc2a3 T A 6: 122,735,583 D234V probably damaging Het
Slco4a1 T C 2: 180,473,108 V608A probably damaging Het
Srrm2 C T 17: 23,816,587 T831I probably benign Het
St18 T A 1: 6,802,317 probably null Het
Tesk2 G C 4: 116,741,896 G67A probably damaging Het
Tlr1 A T 5: 64,925,221 L671H probably damaging Het
Tmem63b A T 17: 45,661,477 Y735N possibly damaging Het
Tmprss11a C T 5: 86,420,079 C263Y probably damaging Het
Trio A T 15: 27,897,991 V345E probably damaging Het
Ubr5 A G 15: 37,997,916 S1674P probably damaging Het
Uchl3 T A 14: 101,695,917 C209S probably damaging Het
Uhmk1 T C 1: 170,211,167 N206S probably damaging Het
Uhrf1 C T 17: 56,318,340 R588W probably damaging Het
Usp28 T C 9: 49,010,250 V256A probably damaging Het
Utrn C A 10: 12,728,777 L552F probably damaging Het
Vmn1r55 A T 7: 5,146,986 M146K probably damaging Het
Vmn1r57 A C 7: 5,221,108 I211L probably benign Het
Zar1 C T 5: 72,577,399 C316Y probably damaging Het
Zc3h11a A T 1: 133,621,674 S750T probably damaging Het
Zcchc6 A G 13: 59,816,656 probably null Het
Zfp366 G A 13: 99,246,168 C613Y probably benign Het
Zfp37 A T 4: 62,191,256 C524S probably damaging Het
Zfp516 T C 18: 82,957,093 V472A probably benign Het
Zhx1 A T 15: 58,052,423 M809K probably damaging Het
Zic1 T C 9: 91,364,371 Y216C probably damaging Het
Other mutations in Hspa1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Hspa1l APN 17 34977465 missense probably damaging 1.00
IGL01548:Hspa1l APN 17 34978391 missense probably damaging 0.98
IGL01860:Hspa1l APN 17 34978811 missense probably benign 0.00
IGL01959:Hspa1l APN 17 34977135 missense probably damaging 1.00
IGL02661:Hspa1l APN 17 34977275 missense probably benign
R0355:Hspa1l UTSW 17 34977410 missense probably benign
R0850:Hspa1l UTSW 17 34977623 missense probably benign 0.01
R1675:Hspa1l UTSW 17 34977443 missense probably damaging 1.00
R2148:Hspa1l UTSW 17 34977390 missense probably damaging 0.98
R2169:Hspa1l UTSW 17 34977323 missense probably benign
R2418:Hspa1l UTSW 17 34977188 missense probably benign 0.05
R4323:Hspa1l UTSW 17 34977856 nonsense probably null
R4924:Hspa1l UTSW 17 34977856 nonsense probably null
R4926:Hspa1l UTSW 17 34978223 missense possibly damaging 0.92
R5653:Hspa1l UTSW 17 34977420 missense probably damaging 1.00
R5790:Hspa1l UTSW 17 34977240 missense probably benign 0.08
R6086:Hspa1l UTSW 17 34978155 missense possibly damaging 0.77
R6237:Hspa1l UTSW 17 34977452 nonsense probably null
R7229:Hspa1l UTSW 17 34977255 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GATCTTCACCACCTACTCGG -3'
(R):5'- TCGGACTCGCTGATCTTGTC -3'

Sequencing Primer
(F):5'- GATCTTCACCACCTACTCGGACAAC -3'
(R):5'- ACAGCGCTCTTCATATTAAAGGCG -3'
Posted On2016-07-06