Incidental Mutation 'R0453:Trim11'
ID39792
Institutional Source Beutler Lab
Gene Symbol Trim11
Ensembl Gene ENSMUSG00000020455
Gene Nametripartite motif-containing 11
Synonyms
MMRRC Submission 038653-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R0453 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location58978093-58991458 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 58990535 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 418 (R418H)
Ref Sequence ENSEMBL: ENSMUSP00000104438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047441] [ENSMUST00000093061] [ENSMUST00000108809] [ENSMUST00000108810]
Predicted Effect probably benign
Transcript: ENSMUST00000047441
SMART Domains Protein: ENSMUSP00000038264
Gene: ENSMUSG00000061462

DomainStartEndE-ValueType
IGc2 21 88 8e-12 SMART
IGc2 121 190 8.31e-10 SMART
low complexity region 191 207 N/A INTRINSIC
IGc2 248 316 4.63e-8 SMART
IG 337 417 5.32e-8 SMART
IG_like 425 506 1.5e2 SMART
FN3 510 596 2.11e-9 SMART
IG 711 790 2.39e-1 SMART
IGc2 876 942 2.54e-5 SMART
IGc2 968 1034 2.54e-5 SMART
IGc2 1060 1126 4.49e-6 SMART
IGc2 1152 1218 7.82e-6 SMART
IGc2 1244 1310 5.16e-6 SMART
IGc2 1336 1402 1.93e-5 SMART
IGc2 1428 1494 1.93e-5 SMART
IGc2 1520 1586 1.93e-5 SMART
IGc2 1612 1678 1.93e-5 SMART
IGc2 1704 1770 1.93e-5 SMART
IGc2 1796 1862 7.94e-7 SMART
IG 1882 1962 5.37e-4 SMART
IG 1972 2051 9.93e-8 SMART
IG 2062 2141 2.48e-8 SMART
IG 2151 2230 3.89e-1 SMART
IG 2240 2319 1.92e0 SMART
IG 2329 2407 6.45e-7 SMART
IG 2452 2531 1.22e-7 SMART
IGc2 2637 2703 9.93e-8 SMART
low complexity region 2705 2716 N/A INTRINSIC
IG 2720 2799 2.44e0 SMART
IGc2 2815 2881 2.1e-6 SMART
IG 2898 2979 2.86e0 SMART
IGc2 2995 3061 8.38e-6 SMART
IG 3078 3157 1.2e-6 SMART
IG 3167 3248 1.42e-3 SMART
IGc2 3264 3330 3.85e-5 SMART
IGc2 3353 3419 3.13e-5 SMART
IGc2 3442 3507 3.3e-4 SMART
IGc2 3530 3595 5.84e-5 SMART
IGc2 3618 3683 1.29e-6 SMART
IG_like 3706 3771 3.16e-1 SMART
IGc2 3779 3844 1.46e-5 SMART
IGc2 3867 3932 1.56e-5 SMART
IGc2 3955 4020 1.19e-5 SMART
IGc2 4043 4108 1.93e-5 SMART
IG 4125 4203 1.85e-7 SMART
IGc2 4219 4285 5.08e-5 SMART
IGc2 4308 4374 1.11e-5 SMART
IGc2 4397 4465 6.71e-5 SMART
IG 4482 4564 2.06e-5 SMART
IG 4574 4655 5.01e-4 SMART
IG 4664 4746 1.04e-1 SMART
FN3 4749 4831 2.44e-14 SMART
IG 4858 4940 3.68e-2 SMART
IQ 5100 5122 3.65e-4 SMART
IGc2 5139 5207 8.72e-4 SMART
low complexity region 5215 5231 N/A INTRINSIC
low complexity region 5232 5248 N/A INTRINSIC
low complexity region 5251 5274 N/A INTRINSIC
IGc2 5369 5437 3.25e-12 SMART
low complexity region 5450 5466 N/A INTRINSIC
IG 5496 5580 1.55e0 SMART
IGc2 5612 5685 1.82e-6 SMART
low complexity region 5799 5829 N/A INTRINSIC
SH3 5832 5895 1.22e0 SMART
Pfam:RhoGEF 5926 6104 4.5e-21 PFAM
PH 6125 6235 2.74e-11 SMART
IGc2 6255 6323 3.73e-12 SMART
IGc2 6349 6418 1.18e-14 SMART
IGc2 6464 6531 1.7e-6 SMART
S_TKc 6562 6815 1.66e-79 SMART
Blast:STYKc 6843 6935 5e-39 BLAST
low complexity region 6939 6954 N/A INTRINSIC
low complexity region 7013 7029 N/A INTRINSIC
low complexity region 7146 7161 N/A INTRINSIC
low complexity region 7199 7219 N/A INTRINSIC
low complexity region 7499 7514 N/A INTRINSIC
IGc2 7538 7606 6.3e-10 SMART
FN3 7620 7698 9.33e-2 SMART
STYKc 7736 7988 8.55e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093061
AA Change: R402H

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000090749
Gene: ENSMUSG00000020455
AA Change: R402H

DomainStartEndE-ValueType
RING 16 56 3.05e-9 SMART
BBOX 87 127 5.81e-6 SMART
coiled coil region 137 207 N/A INTRINSIC
PRY 285 337 4.1e-24 SMART
SPRY 338 457 2.58e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108809
SMART Domains Protein: ENSMUSP00000104437
Gene: ENSMUSG00000020455

DomainStartEndE-ValueType
RING 16 56 3.05e-9 SMART
BBOX 87 127 5.81e-6 SMART
coiled coil region 137 207 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108810
AA Change: R418H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104438
Gene: ENSMUSG00000020455
AA Change: R418H

DomainStartEndE-ValueType
RING 16 56 3.05e-9 SMART
BBOX 87 127 5.81e-6 SMART
coiled coil region 137 207 N/A INTRINSIC
PRY 301 353 4.1e-24 SMART
SPRY 354 473 2.58e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138587
SMART Domains Protein: ENSMUSP00000121092
Gene: ENSMUSG00000061462

DomainStartEndE-ValueType
IG 2 83 1.28e-1 SMART
low complexity region 186 216 N/A INTRINSIC
SH3 219 282 1.22e0 SMART
Pfam:RhoGEF 313 491 6.1e-22 PFAM
PH 512 622 2.74e-11 SMART
IGc2 642 710 3.73e-12 SMART
IGc2 736 805 1.18e-14 SMART
low complexity region 843 857 N/A INTRINSIC
IGc2 985 1052 1.7e-6 SMART
S_TKc 1083 1336 1.66e-79 SMART
Blast:STYKc 1364 1456 1e-38 BLAST
low complexity region 1460 1475 N/A INTRINSIC
low complexity region 1534 1550 N/A INTRINSIC
low complexity region 1667 1682 N/A INTRINSIC
low complexity region 1720 1740 N/A INTRINSIC
low complexity region 2020 2035 N/A INTRINSIC
IGc2 2059 2127 6.3e-10 SMART
FN3 2141 2219 9.33e-2 SMART
STYKc 2257 2509 8.55e-41 SMART
Meta Mutation Damage Score 0.6365 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.6%
Validation Efficiency 99% (97/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein localizes to the nucleus and the cytoplasm. Its function has not been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,753,668 Y715C probably damaging Het
Acad10 T A 5: 121,627,382 K843* probably null Het
Adam26b T C 8: 43,520,350 I538M probably benign Het
Adamtsl1 T C 4: 86,232,615 Y337H probably damaging Het
Ak7 T C 12: 105,716,048 M156T probably damaging Het
Aldh3a1 A G 11: 61,215,512 M238V probably benign Het
Asic4 T A 1: 75,473,511 probably benign Het
AW551984 A G 9: 39,600,641 S25P probably damaging Het
Bbs7 T A 3: 36,607,669 Y127F possibly damaging Het
BC049730 T A 7: 24,714,287 S243T probably benign Het
Bco1 G A 8: 117,108,777 E156K possibly damaging Het
Becn1 T C 11: 101,290,449 D342G probably damaging Het
Birc6 T A 17: 74,649,754 I3575N probably damaging Het
Cc2d2a A T 5: 43,703,294 M522L probably benign Het
Cerkl A G 2: 79,342,451 F293L probably benign Het
Chil3 T G 3: 106,148,905 N311T probably benign Het
Cpeb2 T A 5: 43,285,713 probably benign Het
Cpxm2 A G 7: 132,128,405 S162P probably damaging Het
Cracr2b A C 7: 141,464,263 E136A probably damaging Het
Cyp2a4 T A 7: 26,312,833 M347K probably benign Het
Dicer1 C A 12: 104,702,630 R1264S probably benign Het
Dlgap1 T A 17: 70,761,346 N609K probably benign Het
Dnhd1 A G 7: 105,674,444 T641A probably benign Het
Egfl8 T C 17: 34,614,882 Y74C probably damaging Het
Esyt1 A G 10: 128,512,209 S901P probably benign Het
Fam83e A T 7: 45,723,948 D246V probably damaging Het
Galnt2 T C 8: 124,338,584 probably benign Het
Hdc A G 2: 126,594,951 probably benign Het
Herc1 A C 9: 66,399,772 Q958P probably benign Het
Iqcg T A 16: 33,049,843 probably benign Het
Iqub A T 6: 24,450,830 F590Y probably damaging Het
Jak2 T C 19: 29,311,838 I1130T probably benign Het
Kbtbd11 G A 8: 15,027,499 A33T probably benign Het
Kcnip4 A G 5: 48,509,712 L37P probably damaging Het
Klk6 A G 7: 43,828,539 N112D probably damaging Het
Kmt2c G A 5: 25,354,747 T1011I probably damaging Het
Knl1 A T 2: 119,068,388 K190M probably damaging Het
Lama3 T A 18: 12,465,478 S981T possibly damaging Het
Lrrc18 T C 14: 33,008,651 L49P probably damaging Het
Lrrc31 T C 3: 30,687,525 E245G probably damaging Het
Macf1 T C 4: 123,444,944 I2456M probably benign Het
Mcm6 T A 1: 128,333,555 T771S probably benign Het
Met A C 6: 17,534,198 Y680S possibly damaging Het
Mixl1 T A 1: 180,696,646 T123S probably damaging Het
Myh8 A T 11: 67,292,905 I787F probably benign Het
Myocd A G 11: 65,196,225 F292S probably damaging Het
Neb T C 2: 52,313,890 probably null Het
Nfe2l1 A G 11: 96,827,368 S114P probably damaging Het
Nrxn2 T C 19: 6,491,521 S986P probably damaging Het
Olfr1246 A T 2: 89,590,751 Y121* probably null Het
Olfr1453 T G 19: 13,027,931 T133P probably damaging Het
Olfr25 A T 9: 38,330,171 T195S probably benign Het
Olfr745 T C 14: 50,643,004 V241A possibly damaging Het
Olfr767 A G 10: 129,079,771 F64S probably damaging Het
Olfr920 G A 9: 38,756,129 G147D probably damaging Het
Oprl1 T C 2: 181,718,734 probably null Het
Panx2 T A 15: 89,068,407 I359N probably damaging Het
Pik3c2b T A 1: 133,077,396 V545E probably damaging Het
Piwil4 T C 9: 14,727,452 N259S probably benign Het
Plcxd2 A T 16: 45,980,556 F102I probably damaging Het
Pld5 A T 1: 176,089,956 M75K possibly damaging Het
Pmp22 T A 11: 63,151,103 probably benign Het
Polr2a A G 11: 69,741,019 S1074P possibly damaging Het
Pop1 T A 15: 34,526,206 V649E possibly damaging Het
Prc1 A G 7: 80,313,102 N548S probably damaging Het
Prss51 T C 14: 64,097,139 L202P probably damaging Het
Rhpn1 T C 15: 75,713,579 S576P possibly damaging Het
Rictor A G 15: 6,708,642 D20G probably benign Het
Rpl13a-ps1 A T 19: 50,030,206 L177* probably null Het
Rpl23a-ps1 T G 1: 45,981,927 noncoding transcript Het
Saa2 A G 7: 46,753,478 D51G probably damaging Het
Sec31a A T 5: 100,404,118 probably benign Het
Secisbp2 G A 13: 51,683,325 E841K possibly damaging Het
Serinc1 A G 10: 57,517,210 Y437H probably damaging Het
Slc39a12 A T 2: 14,435,681 H481L probably benign Het
Suz12 T A 11: 80,030,033 N586K probably damaging Het
Synm T C 7: 67,736,882 Y344C possibly damaging Het
Tas2r104 A G 6: 131,685,341 V135A probably benign Het
Tdrd9 T C 12: 112,068,239 S1371P probably benign Het
Tg T A 15: 66,828,533 D893E probably benign Het
Thoc5 C A 11: 4,918,217 D423E possibly damaging Het
Trim52 T G 14: 106,106,965 V19G probably damaging Het
Tuba4a C A 1: 75,215,858 V371L probably damaging Het
Ugt8a A G 3: 125,914,957 V168A probably benign Het
Ulk1 C T 5: 110,791,085 G496R probably damaging Het
Usp40 A G 1: 87,946,598 *1236Q probably null Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r24 A G 6: 123,780,391 probably null Het
Vmn2r53 A G 7: 12,582,411 Y494H probably damaging Het
Vmn2r65 T A 7: 84,946,234 D414V probably benign Het
Wdr26 A T 1: 181,182,879 L519* probably null Het
Wnk1 A G 6: 119,963,151 V173A probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp318 T C 17: 46,396,708 S231P probably damaging Het
Zfp398 T C 6: 47,865,848 V146A probably benign Het
Zfp410 T C 12: 84,331,712 M270T probably damaging Het
Zfp445 A T 9: 122,853,513 H454Q possibly damaging Het
Other mutations in Trim11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Trim11 APN 11 58990697 missense probably benign
R0565:Trim11 UTSW 11 58990584 missense probably damaging 1.00
R2061:Trim11 UTSW 11 58982063 missense probably damaging 1.00
R4783:Trim11 UTSW 11 58988924 missense probably null 1.00
R5004:Trim11 UTSW 11 58981338 critical splice donor site probably benign
R5847:Trim11 UTSW 11 58990593 missense probably damaging 1.00
R6027:Trim11 UTSW 11 58978463 missense possibly damaging 0.76
R6928:Trim11 UTSW 11 58988843 missense probably damaging 1.00
R7128:Trim11 UTSW 11 58978277 missense probably damaging 1.00
R7389:Trim11 UTSW 11 58990655 missense probably damaging 1.00
R7485:Trim11 UTSW 11 58978637 missense probably benign 0.00
R7535:Trim11 UTSW 11 58982065 missense probably damaging 0.99
R7629:Trim11 UTSW 11 58978334 missense probably damaging 1.00
R7734:Trim11 UTSW 11 58978354 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCACTCGGCGTGTGTAAAGAAAC -3'
(R):5'- TCAGAAAGGCACTGTGTGCTCCTC -3'

Sequencing Primer
(F):5'- CGTGTGTAAAGAAACTGCCAAC -3'
(R):5'- GTGTCCCCAGATACACCTATCAG -3'
Posted On2013-05-23