Incidental Mutation 'R5186:Uhrf1'
ID397923
Institutional Source Beutler Lab
Gene Symbol Uhrf1
Ensembl Gene ENSMUSG00000001228
Gene Nameubiquitin-like, containing PHD and RING finger domains, 1
SynonymsICBP90, Np95
MMRRC Submission 042765-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5186 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location56303321-56323486 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 56318340 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 588 (R588W)
Ref Sequence ENSEMBL: ENSMUSP00000108661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001258] [ENSMUST00000113035] [ENSMUST00000113038] [ENSMUST00000113039]
Predicted Effect probably damaging
Transcript: ENSMUST00000001258
AA Change: R596W

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000001258
Gene: ENSMUSG00000001228
AA Change: R596W

DomainStartEndE-ValueType
UBQ 1 74 9.37e-10 SMART
Pfam:DUF3590 136 232 1.1e-42 PFAM
PHD 322 369 6.39e-12 SMART
RING 323 368 1.09e0 SMART
low complexity region 381 398 N/A INTRINSIC
SRA 419 590 8.5e-113 SMART
low complexity region 635 653 N/A INTRINSIC
RING 713 751 8.43e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113035
AA Change: R588W

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108658
Gene: ENSMUSG00000001228
AA Change: R588W

DomainStartEndE-ValueType
UBQ 1 74 9.37e-10 SMART
Pfam:DUF3590 136 232 1.1e-42 PFAM
PHD 314 361 6.39e-12 SMART
RING 315 360 1.09e0 SMART
low complexity region 373 390 N/A INTRINSIC
SRA 411 582 8.5e-113 SMART
low complexity region 627 645 N/A INTRINSIC
RING 705 743 8.43e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113038
AA Change: R588W

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108661
Gene: ENSMUSG00000001228
AA Change: R588W

DomainStartEndE-ValueType
UBQ 1 74 9.37e-10 SMART
Pfam:DUF3590 136 232 1.1e-42 PFAM
PHD 314 361 6.39e-12 SMART
RING 315 360 1.09e0 SMART
low complexity region 373 390 N/A INTRINSIC
SRA 411 582 8.5e-113 SMART
low complexity region 627 645 N/A INTRINSIC
RING 705 743 8.43e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113039
AA Change: R596W

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108662
Gene: ENSMUSG00000001228
AA Change: R596W

DomainStartEndE-ValueType
UBQ 1 74 9.37e-10 SMART
Pfam:TTD 128 281 8e-61 PFAM
PHD 322 369 6.39e-12 SMART
RING 323 368 1.09e0 SMART
low complexity region 381 398 N/A INTRINSIC
SRA 419 590 8.5e-113 SMART
low complexity region 635 653 N/A INTRINSIC
RING 713 751 8.43e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139654
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of RING-finger type E3 ubiquitin ligases. The protein binds to specific DNA sequences, and recruits a histone deacetylase to regulate gene expression. Its expression peaks at late G1 phase and continues during G2 and M phases of the cell cycle. It plays a major role in the G1/S transition by regulating topoisomerase IIalpha and retinoblastoma gene expression, and functions in the p53-dependent DNA damage checkpoint. It is regarded as a hub protein for the integration of epigenetic information. This gene is up-regulated in various cancers, and it is therefore considered to be a therapeutic target. Multiple transcript variants encoding different isoforms have been found for this gene. A related pseudogene exists on chromosome 12. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for disruption of this marker die early in gestation showing growth retardation and various malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,743,739 L89H probably damaging Het
Abca8a T C 11: 110,091,599 I6V probably null Het
Aox1 A G 1: 58,068,370 D601G probably damaging Het
Asic1 GCACC GCACCACC 15: 99,698,803 probably benign Het
Cacna1g T G 11: 94,442,848 N931T probably damaging Het
Ccdc14 T C 16: 34,721,585 F511L probably damaging Het
Cd177 T A 7: 24,744,923 E710V probably benign Het
Cep112 T C 11: 108,752,560 C49R probably benign Het
Clip2 G A 5: 134,522,791 T159M possibly damaging Het
Dnah2 T C 11: 69,435,884 N3575S probably damaging Het
Dnah6 T A 6: 73,067,427 I3234F probably damaging Het
Eci3 G T 13: 34,946,978 A302E possibly damaging Het
Fam204a T C 19: 60,199,989 K214E probably damaging Het
Fam78a T C 2: 32,082,654 T85A possibly damaging Het
Flnb T C 14: 7,909,748 Y1401H probably damaging Het
Foxl2 A T 9: 98,956,055 D132V probably damaging Het
Frs2 C A 10: 117,078,842 W57C probably damaging Het
Gm26558 G T 2: 70,661,417 probably benign Het
Gpr139 A G 7: 119,144,840 V174A probably benign Het
Grik5 T C 7: 25,015,819 T676A probably damaging Het
H60c T C 10: 3,259,273 probably null Het
Hspa1l A G 17: 34,978,469 K495E probably damaging Het
Irgm1 C T 11: 48,866,217 V256I probably benign Het
Kat7 T A 11: 95,286,416 T293S probably benign Het
Lipg C T 18: 74,960,938 V13I probably benign Het
Lrrn1 A T 6: 107,569,224 Y661F probably damaging Het
Mllt3 A G 4: 87,840,995 V272A probably benign Het
Mx1 G A 16: 97,455,494 R162C probably benign Het
Myo18b T A 5: 112,871,470 D647V probably damaging Het
Naf1 G A 8: 66,879,646 V329I probably benign Het
Olfr1286 A T 2: 111,420,774 M59K probably damaging Het
Olfr654 A T 7: 104,588,211 I153F probably damaging Het
Olfr936 A T 9: 39,046,969 C194* probably null Het
P2rx5 G A 11: 73,171,790 V442M possibly damaging Het
Pcdhb9 A G 18: 37,401,232 E93G probably damaging Het
Pcdhga4 A T 18: 37,687,426 N676I probably benign Het
Pgm5 A G 19: 24,820,128 M230T probably damaging Het
Pik3c2g T C 6: 139,622,018 V44A probably damaging Het
Pp2d1 T C 17: 53,508,140 M519V probably benign Het
Ppp1r10 A G 17: 35,928,511 E404G probably damaging Het
Prpf8 A T 11: 75,489,783 E104V possibly damaging Het
Ptpa T C 2: 30,438,355 probably null Het
Pygl A C 12: 70,201,344 N248K probably damaging Het
Rbm8a A G 3: 96,630,932 D102G probably damaging Het
Sema3d A G 5: 12,584,908 D647G probably benign Het
Serpinb11 A T 1: 107,379,754 D305V probably damaging Het
Slc12a8 T C 16: 33,617,208 I337T probably damaging Het
Slc29a2 G A 19: 5,028,967 R286Q probably benign Het
Slc2a3 T A 6: 122,735,583 D234V probably damaging Het
Slco4a1 T C 2: 180,473,108 V608A probably damaging Het
Srrm2 C T 17: 23,816,587 T831I probably benign Het
St18 T A 1: 6,802,317 probably null Het
Tesk2 G C 4: 116,741,896 G67A probably damaging Het
Tlr1 A T 5: 64,925,221 L671H probably damaging Het
Tmem63b A T 17: 45,661,477 Y735N possibly damaging Het
Tmprss11a C T 5: 86,420,079 C263Y probably damaging Het
Trio A T 15: 27,897,991 V345E probably damaging Het
Ubr5 A G 15: 37,997,916 S1674P probably damaging Het
Uchl3 T A 14: 101,695,917 C209S probably damaging Het
Uhmk1 T C 1: 170,211,167 N206S probably damaging Het
Usp28 T C 9: 49,010,250 V256A probably damaging Het
Utrn C A 10: 12,728,777 L552F probably damaging Het
Vmn1r55 A T 7: 5,146,986 M146K probably damaging Het
Vmn1r57 A C 7: 5,221,108 I211L probably benign Het
Zar1 C T 5: 72,577,399 C316Y probably damaging Het
Zc3h11a A T 1: 133,621,674 S750T probably damaging Het
Zcchc6 A G 13: 59,816,656 probably null Het
Zfp366 G A 13: 99,246,168 C613Y probably benign Het
Zfp37 A T 4: 62,191,256 C524S probably damaging Het
Zfp516 T C 18: 82,957,093 V472A probably benign Het
Zhx1 A T 15: 58,052,423 M809K probably damaging Het
Zic1 T C 9: 91,364,371 Y216C probably damaging Het
Other mutations in Uhrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00560:Uhrf1 APN 17 56318125 missense probably damaging 1.00
IGL00925:Uhrf1 APN 17 56320535 missense probably benign 0.00
IGL01432:Uhrf1 APN 17 56318250 missense probably damaging 1.00
IGL02739:Uhrf1 APN 17 56305129 missense probably benign 0.03
R0667:Uhrf1 UTSW 17 56310677 missense probably benign 0.01
R0685:Uhrf1 UTSW 17 56310742 missense probably damaging 0.99
R1121:Uhrf1 UTSW 17 56312917 missense probably benign
R1462:Uhrf1 UTSW 17 56318035 missense probably damaging 1.00
R1462:Uhrf1 UTSW 17 56318035 missense probably damaging 1.00
R2088:Uhrf1 UTSW 17 56318089 missense probably damaging 1.00
R2329:Uhrf1 UTSW 17 56310671 splice site probably null
R2331:Uhrf1 UTSW 17 56310671 splice site probably null
R2332:Uhrf1 UTSW 17 56310671 splice site probably null
R3624:Uhrf1 UTSW 17 56317023 missense probably damaging 1.00
R4065:Uhrf1 UTSW 17 56318020 missense probably damaging 1.00
R4882:Uhrf1 UTSW 17 56309401 missense probably damaging 1.00
R4901:Uhrf1 UTSW 17 56310834 missense probably benign 0.01
R4913:Uhrf1 UTSW 17 56315478 missense probably damaging 0.99
R5061:Uhrf1 UTSW 17 56320542 splice site probably null
R5711:Uhrf1 UTSW 17 56320259 missense possibly damaging 0.49
R6917:Uhrf1 UTSW 17 56309574 missense probably damaging 1.00
R7021:Uhrf1 UTSW 17 56320450 missense probably benign 0.04
R7241:Uhrf1 UTSW 17 56315193 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACAGCAAGTACGCTCCTG -3'
(R):5'- CAGAAACCTTGGAGAGCCTG -3'

Sequencing Primer
(F):5'- CCGCTATGATGGCATCTACAAGG -3'
(R):5'- TTGGAGAGCCTGGGACCTG -3'
Posted On2016-07-06