Incidental Mutation 'R5186:Lipg'
ID 397928
Institutional Source Beutler Lab
Gene Symbol Lipg
Ensembl Gene ENSMUSG00000053846
Gene Name lipase, endothelial
Synonyms endothelial lipase, EL, mEDL, 3110013K01Rik
MMRRC Submission 042765-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock # R5186 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 74939322-74961263 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 74960938 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 13 (V13I)
Ref Sequence ENSEMBL: ENSMUSP00000066536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066532]
AlphaFold Q9WVG5
Predicted Effect probably benign
Transcript: ENSMUST00000066532
AA Change: V13I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000066536
Gene: ENSMUSG00000053846
AA Change: V13I

DomainStartEndE-ValueType
Pfam:Lipase 20 344 3.1e-108 PFAM
LH2 347 483 5.66e-6 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has substantial phospholipase activity and may be involved in lipoprotein metabolism and vascular biology. This protein is designated a member of the TG lipase family by its sequence and characteristic lid region which provides substrate specificity for enzymes of the TG lipase family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased circulating total cholesterol and HDL as well as decreased monocyte binding to vascular endothelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,743,739 L89H probably damaging Het
Abca8a T C 11: 110,091,599 I6V probably null Het
Aox1 A G 1: 58,068,370 D601G probably damaging Het
Asic1 GCACC GCACCACC 15: 99,698,803 probably benign Het
Cacna1g T G 11: 94,442,848 N931T probably damaging Het
Ccdc14 T C 16: 34,721,585 F511L probably damaging Het
Cd177 T A 7: 24,744,923 E710V probably benign Het
Cep112 T C 11: 108,752,560 C49R probably benign Het
Clip2 G A 5: 134,522,791 T159M possibly damaging Het
Dnah2 T C 11: 69,435,884 N3575S probably damaging Het
Dnah6 T A 6: 73,067,427 I3234F probably damaging Het
Eci3 G T 13: 34,946,978 A302E possibly damaging Het
Fam204a T C 19: 60,199,989 K214E probably damaging Het
Fam78a T C 2: 32,082,654 T85A possibly damaging Het
Flnb T C 14: 7,909,748 Y1401H probably damaging Het
Foxl2 A T 9: 98,956,055 D132V probably damaging Het
Frs2 C A 10: 117,078,842 W57C probably damaging Het
Gm26558 G T 2: 70,661,417 probably benign Het
Gpr139 A G 7: 119,144,840 V174A probably benign Het
Grik5 T C 7: 25,015,819 T676A probably damaging Het
H60c T C 10: 3,259,273 probably null Het
Hspa1l A G 17: 34,978,469 K495E probably damaging Het
Irgm1 C T 11: 48,866,217 V256I probably benign Het
Kat7 T A 11: 95,286,416 T293S probably benign Het
Lrrn1 A T 6: 107,569,224 Y661F probably damaging Het
Mllt3 A G 4: 87,840,995 V272A probably benign Het
Mx1 G A 16: 97,455,494 R162C probably benign Het
Myo18b T A 5: 112,871,470 D647V probably damaging Het
Naf1 G A 8: 66,879,646 V329I probably benign Het
Olfr1286 A T 2: 111,420,774 M59K probably damaging Het
Olfr654 A T 7: 104,588,211 I153F probably damaging Het
Olfr936 A T 9: 39,046,969 C194* probably null Het
P2rx5 G A 11: 73,171,790 V442M possibly damaging Het
Pcdhb9 A G 18: 37,401,232 E93G probably damaging Het
Pcdhga4 A T 18: 37,687,426 N676I probably benign Het
Pgm5 A G 19: 24,820,128 M230T probably damaging Het
Pik3c2g T C 6: 139,622,018 V44A probably damaging Het
Pp2d1 T C 17: 53,508,140 M519V probably benign Het
Ppp1r10 A G 17: 35,928,511 E404G probably damaging Het
Prpf8 A T 11: 75,489,783 E104V possibly damaging Het
Ptpa T C 2: 30,438,355 probably null Het
Pygl A C 12: 70,201,344 N248K probably damaging Het
Rbm8a A G 3: 96,630,932 D102G probably damaging Het
Sema3d A G 5: 12,584,908 D647G probably benign Het
Serpinb11 A T 1: 107,379,754 D305V probably damaging Het
Slc12a8 T C 16: 33,617,208 I337T probably damaging Het
Slc29a2 G A 19: 5,028,967 R286Q probably benign Het
Slc2a3 T A 6: 122,735,583 D234V probably damaging Het
Slco4a1 T C 2: 180,473,108 V608A probably damaging Het
Srrm2 C T 17: 23,816,587 T831I probably benign Het
St18 T A 1: 6,802,317 probably null Het
Tesk2 G C 4: 116,741,896 G67A probably damaging Het
Tlr1 A T 5: 64,925,221 L671H probably damaging Het
Tmem63b A T 17: 45,661,477 Y735N possibly damaging Het
Tmprss11a C T 5: 86,420,079 C263Y probably damaging Het
Trio A T 15: 27,897,991 V345E probably damaging Het
Ubr5 A G 15: 37,997,916 S1674P probably damaging Het
Uchl3 T A 14: 101,695,917 C209S probably damaging Het
Uhmk1 T C 1: 170,211,167 N206S probably damaging Het
Uhrf1 C T 17: 56,318,340 R588W probably damaging Het
Usp28 T C 9: 49,010,250 V256A probably damaging Het
Utrn C A 10: 12,728,777 L552F probably damaging Het
Vmn1r55 A T 7: 5,146,986 M146K probably damaging Het
Vmn1r57 A C 7: 5,221,108 I211L probably benign Het
Zar1 C T 5: 72,577,399 C316Y probably damaging Het
Zc3h11a A T 1: 133,621,674 S750T probably damaging Het
Zcchc6 A G 13: 59,816,656 probably null Het
Zfp366 G A 13: 99,246,168 C613Y probably benign Het
Zfp37 A T 4: 62,191,256 C524S probably damaging Het
Zfp516 T C 18: 82,957,093 V472A probably benign Het
Zhx1 A T 15: 58,052,423 M809K probably damaging Het
Zic1 T C 9: 91,364,371 Y216C probably damaging Het
Other mutations in Lipg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01705:Lipg APN 18 74947971 critical splice donor site probably null
IGL02340:Lipg APN 18 74960875 splice site probably null
IGL02804:Lipg APN 18 74949088 missense probably damaging 0.98
listube UTSW 18 74957236 missense probably benign 0.00
R0094:Lipg UTSW 18 74945846 missense probably benign 0.14
R0172:Lipg UTSW 18 74948174 missense possibly damaging 0.94
R0316:Lipg UTSW 18 74960941 missense probably benign 0.01
R0535:Lipg UTSW 18 74954220 missense probably damaging 1.00
R0567:Lipg UTSW 18 74957369 missense probably benign 0.01
R1171:Lipg UTSW 18 74945823 missense possibly damaging 0.71
R1554:Lipg UTSW 18 74948047 missense probably damaging 1.00
R1611:Lipg UTSW 18 74948059 missense possibly damaging 0.81
R1916:Lipg UTSW 18 74960937 missense probably benign 0.00
R2125:Lipg UTSW 18 74945885 missense probably benign
R4196:Lipg UTSW 18 74945831 missense probably damaging 1.00
R4629:Lipg UTSW 18 74948036 nonsense probably null
R5424:Lipg UTSW 18 74954253 missense probably damaging 1.00
R5708:Lipg UTSW 18 74955434 missense possibly damaging 0.49
R6416:Lipg UTSW 18 74957236 missense probably benign 0.00
R6493:Lipg UTSW 18 74948024 missense probably damaging 0.99
R6601:Lipg UTSW 18 74948204 missense probably benign
R7199:Lipg UTSW 18 74955584 missense probably benign 0.01
R7857:Lipg UTSW 18 74945820 missense probably damaging 1.00
R7884:Lipg UTSW 18 74948007 missense probably damaging 1.00
R9143:Lipg UTSW 18 74954201 missense probably benign 0.00
Z1177:Lipg UTSW 18 74941340 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGGAAAGGATTTCTTTGGGACC -3'
(R):5'- TGGCGATGGGTCAGATGACTAG -3'

Sequencing Primer
(F):5'- TCTTTGGGACCTAGAAGCACTGAC -3'
(R):5'- AAAAGTACCTCTCCTGGAGTTCG -3'
Posted On 2016-07-06