Mutagenetix > Incidental Mutation

Incidental Mutation 'R5186:Zfp516'

397929

Institutional Source

Beutler Lab

Gene Symbol

Zfp516

Ensembl Gene

ENSMUSG00000058881

Gene Name

zinc finger protein 516

Synonyms

C330029B10Rik, Zfp26l

MMRRC Submission

042765-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.288) question?

Stock #

R5186 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

82910879-83005314 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 82957093 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 472 (V472A)

Ref Sequence

ENSEMBL: ENSMUSP00000126629 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071233] [ENSMUST00000171238]

AlphaFold

Q7TSH3

Predicted Effect

probably benign
Transcript: ENSMUST00000071233
AA Change: V472A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000071216
Gene: ENSMUSG00000058881
AA Change: V472A

Domain	Start	End	E-Value	Type
low complexity region	12	23	N/A	INTRINSIC
ZnF_C2H2	34	56	1.03e-2	SMART
ZnF_C2H2	62	84	3.95e-4	SMART
ZnF_C2H2	162	185	8.09e-1	SMART
ZnF_C2H2	188	211	1.76e-1	SMART
ZnF_C2H2	236	258	3.16e-3	SMART
ZnF_C2H2	264	286	3.34e-2	SMART
ZnF_C2H2	323	345	2.63e0	SMART
ZnF_C2H2	504	526	5.72e-1	SMART
low complexity region	527	544	N/A	INTRINSIC
ZnF_C2H2	753	776	2.97e1	SMART
low complexity region	834	846	N/A	INTRINSIC
ZnF_C2H2	1092	1114	1.12e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000171238
AA Change: V472A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000126629
Gene: ENSMUSG00000058881
AA Change: V472A

Domain	Start	End	E-Value	Type
low complexity region	12	23	N/A	INTRINSIC
ZnF_C2H2	34	56	1.03e-2	SMART
ZnF_C2H2	62	84	3.95e-4	SMART
ZnF_C2H2	162	185	8.09e-1	SMART
ZnF_C2H2	188	211	1.76e-1	SMART
ZnF_C2H2	236	258	3.16e-3	SMART
ZnF_C2H2	264	286	3.34e-2	SMART
ZnF_C2H2	323	345	2.63e0	SMART
ZnF_C2H2	504	526	5.72e-1	SMART
low complexity region	527	544	N/A	INTRINSIC
ZnF_C2H2	753	776	2.97e1	SMART
low complexity region	834	846	N/A	INTRINSIC
ZnF_C2H2	1092	1114	1.12e-3	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc-finger proteins bind nucleic acids and play important roles in various cellular functions, including cell proliferation, differentiation, and apoptosis. This gene encodes a zinc-finger protein, and belongs to the krueppel C2H2-type zinc-finger protein family. It may be involved in transcriptional regulation. [provided by RefSeq, Sep 2012]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	T	13: 59,743,739	L89H	probably damaging	Het
Abca8a	T	C	11: 110,091,599	I6V	probably null	Het
Aox1	A	G	1: 58,068,370	D601G	probably damaging	Het
Asic1	GCACC	GCACCACC	15: 99,698,803		probably benign	Het
Cacna1g	T	G	11: 94,442,848	N931T	probably damaging	Het
Ccdc14	T	C	16: 34,721,585	F511L	probably damaging	Het
Cd177	T	A	7: 24,744,923	E710V	probably benign	Het
Cep112	T	C	11: 108,752,560	C49R	probably benign	Het
Clip2	G	A	5: 134,522,791	T159M	possibly damaging	Het
Dnah2	T	C	11: 69,435,884	N3575S	probably damaging	Het
Dnah6	T	A	6: 73,067,427	I3234F	probably damaging	Het
Eci3	G	T	13: 34,946,978	A302E	possibly damaging	Het
Fam204a	T	C	19: 60,199,989	K214E	probably damaging	Het
Fam78a	T	C	2: 32,082,654	T85A	possibly damaging	Het
Flnb	T	C	14: 7,909,748	Y1401H	probably damaging	Het
Foxl2	A	T	9: 98,956,055	D132V	probably damaging	Het
Frs2	C	A	10: 117,078,842	W57C	probably damaging	Het
Gm26558	G	T	2: 70,661,417		probably benign	Het
Gpr139	A	G	7: 119,144,840	V174A	probably benign	Het
Grik5	T	C	7: 25,015,819	T676A	probably damaging	Het
H60c	T	C	10: 3,259,273		probably null	Het
Hspa1l	A	G	17: 34,978,469	K495E	probably damaging	Het
Irgm1	C	T	11: 48,866,217	V256I	probably benign	Het
Kat7	T	A	11: 95,286,416	T293S	probably benign	Het
Lipg	C	T	18: 74,960,938	V13I	probably benign	Het
Lrrn1	A	T	6: 107,569,224	Y661F	probably damaging	Het
Mllt3	A	G	4: 87,840,995	V272A	probably benign	Het
Mx1	G	A	16: 97,455,494	R162C	probably benign	Het
Myo18b	T	A	5: 112,871,470	D647V	probably damaging	Het
Naf1	G	A	8: 66,879,646	V329I	probably benign	Het
Olfr1286	A	T	2: 111,420,774	M59K	probably damaging	Het
Olfr654	A	T	7: 104,588,211	I153F	probably damaging	Het
Olfr936	A	T	9: 39,046,969	C194*	probably null	Het
P2rx5	G	A	11: 73,171,790	V442M	possibly damaging	Het
Pcdhb9	A	G	18: 37,401,232	E93G	probably damaging	Het
Pcdhga4	A	T	18: 37,687,426	N676I	probably benign	Het
Pgm5	A	G	19: 24,820,128	M230T	probably damaging	Het
Pik3c2g	T	C	6: 139,622,018	V44A	probably damaging	Het
Pp2d1	T	C	17: 53,508,140	M519V	probably benign	Het
Ppp1r10	A	G	17: 35,928,511	E404G	probably damaging	Het
Prpf8	A	T	11: 75,489,783	E104V	possibly damaging	Het
Ptpa	T	C	2: 30,438,355		probably null	Het
Pygl	A	C	12: 70,201,344	N248K	probably damaging	Het
Rbm8a	A	G	3: 96,630,932	D102G	probably damaging	Het
Sema3d	A	G	5: 12,584,908	D647G	probably benign	Het
Serpinb11	A	T	1: 107,379,754	D305V	probably damaging	Het
Slc12a8	T	C	16: 33,617,208	I337T	probably damaging	Het
Slc29a2	G	A	19: 5,028,967	R286Q	probably benign	Het
Slc2a3	T	A	6: 122,735,583	D234V	probably damaging	Het
Slco4a1	T	C	2: 180,473,108	V608A	probably damaging	Het
Srrm2	C	T	17: 23,816,587	T831I	probably benign	Het
St18	T	A	1: 6,802,317		probably null	Het
Tesk2	G	C	4: 116,741,896	G67A	probably damaging	Het
Tlr1	A	T	5: 64,925,221	L671H	probably damaging	Het
Tmem63b	A	T	17: 45,661,477	Y735N	possibly damaging	Het
Tmprss11a	C	T	5: 86,420,079	C263Y	probably damaging	Het
Trio	A	T	15: 27,897,991	V345E	probably damaging	Het
Ubr5	A	G	15: 37,997,916	S1674P	probably damaging	Het
Uchl3	T	A	14: 101,695,917	C209S	probably damaging	Het
Uhmk1	T	C	1: 170,211,167	N206S	probably damaging	Het
Uhrf1	C	T	17: 56,318,340	R588W	probably damaging	Het
Usp28	T	C	9: 49,010,250	V256A	probably damaging	Het
Utrn	C	A	10: 12,728,777	L552F	probably damaging	Het
Vmn1r55	A	T	7: 5,146,986	M146K	probably damaging	Het
Vmn1r57	A	C	7: 5,221,108	I211L	probably benign	Het
Zar1	C	T	5: 72,577,399	C316Y	probably damaging	Het
Zc3h11a	A	T	1: 133,621,674	S750T	probably damaging	Het
Zcchc6	A	G	13: 59,816,656		probably null	Het
Zfp366	G	A	13: 99,246,168	C613Y	probably benign	Het
Zfp37	A	T	4: 62,191,256	C524S	probably damaging	Het
Zhx1	A	T	15: 58,052,423	M809K	probably damaging	Het
Zic1	T	C	9: 91,364,371	Y216C	probably damaging	Het

Other mutations in Zfp516

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00434:Zfp516	APN	18	82957108	missense	probably benign	0.08
IGL01343:Zfp516	APN	18	82993096	missense	probably damaging	0.99
IGL01413:Zfp516	APN	18	82987670	nonsense	probably null
IGL01684:Zfp516	APN	18	82957201	missense	probably damaging	1.00
IGL01820:Zfp516	APN	18	82987361	missense	probably benign	0.00
IGL02081:Zfp516	APN	18	82955733	missense	probably benign	0.00
IGL02209:Zfp516	APN	18	82994497	missense	probably benign
IGL02253:Zfp516	APN	18	82994497	missense	probably benign
IGL03028:Zfp516	APN	18	82955913	missense	possibly damaging	0.95
IGL03241:Zfp516	APN	18	82987520	missense	probably benign	0.01
R0379:Zfp516	UTSW	18	82987670	nonsense	probably null
R0426:Zfp516	UTSW	18	82955772	missense	probably benign	0.04
R0466:Zfp516	UTSW	18	82957454	splice site	probably null
R0715:Zfp516	UTSW	18	82987263	missense	probably damaging	1.00
R1574:Zfp516	UTSW	18	82993175	missense	possibly damaging	0.93
R1574:Zfp516	UTSW	18	82993175	missense	possibly damaging	0.93
R2110:Zfp516	UTSW	18	82957411	missense	probably damaging	0.99
R2112:Zfp516	UTSW	18	82957411	missense	probably damaging	0.99
R2162:Zfp516	UTSW	18	82986938	missense	possibly damaging	0.95
R2223:Zfp516	UTSW	18	82955770	missense	possibly damaging	0.94
R4097:Zfp516	UTSW	18	82987256	missense	possibly damaging	0.95
R4299:Zfp516	UTSW	18	82987497	missense	possibly damaging	0.80
R4378:Zfp516	UTSW	18	82987180	missense	probably benign	0.00
R4601:Zfp516	UTSW	18	82956039	missense	probably benign	0.14
R4721:Zfp516	UTSW	18	82957111	missense	possibly damaging	0.49
R4946:Zfp516	UTSW	18	82956094	missense	probably benign	0.06
R5351:Zfp516	UTSW	18	82956751	missense	probably benign	0.00
R5937:Zfp516	UTSW	18	82956833	missense	probably damaging	0.99
R5998:Zfp516	UTSW	18	82956514	missense	probably damaging	1.00
R6458:Zfp516	UTSW	18	82987350	missense	probably benign	0.03
R6513:Zfp516	UTSW	18	82955710	missense	probably damaging	1.00
R6626:Zfp516	UTSW	18	82988107	missense	probably damaging	1.00
R6712:Zfp516	UTSW	18	82957308	missense	probably damaging	1.00
R6877:Zfp516	UTSW	18	82955791	missense	probably damaging	1.00
R6886:Zfp516	UTSW	18	82957000	missense	probably benign	0.06
R7073:Zfp516	UTSW	18	82988200	critical splice donor site	probably null
R7463:Zfp516	UTSW	18	82957108	missense	probably benign	0.08
R7863:Zfp516	UTSW	18	83001328	missense	probably benign	0.00
R8097:Zfp516	UTSW	18	82987170	nonsense	probably null
R8244:Zfp516	UTSW	18	82956333	missense	probably damaging	1.00
R8245:Zfp516	UTSW	18	82956333	missense	probably damaging	1.00
R8362:Zfp516	UTSW	18	82986894	missense	probably benign	0.01
R8410:Zfp516	UTSW	18	82956333	missense	probably damaging	1.00
R8780:Zfp516	UTSW	18	82987955	missense	probably benign
R8791:Zfp516	UTSW	18	82957335	missense	probably damaging	1.00
R9066:Zfp516	UTSW	18	82955839	missense	probably damaging	1.00
R9556:Zfp516	UTSW	18	82956840	missense	probably benign	0.00
X0019:Zfp516	UTSW	18	82987488	missense	probably damaging	1.00
X0065:Zfp516	UTSW	18	82987169	missense	probably damaging	1.00
Z1176:Zfp516	UTSW	18	82987533	missense	probably benign	0.01
Z1177:Zfp516	UTSW	18	82956066	missense	probably damaging	1.00
Z1177:Zfp516	UTSW	18	82956067	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTAGCTACCAGGGGTAAG -3'
(R):5'- CTACACGGGGTACTTGAACC -3'

Sequencing Primer
(F):5'- CTACCAGGGGTAAGGTGGCTG -3'
(R):5'- GGGTACTTGAACCTCATCCG -3'

Posted On

2016-07-06