Mutagenetix > Incidental Mutations

Incidental Mutation 'R5186:Slc29a2'

397930

Institutional Source

Beutler Lab

Gene Symbol

Slc29a2

Ensembl Gene

ENSMUSG00000024891

Gene Name

solute carrier family 29 (nucleoside transporters), member 2

Synonyms

HNP36, ENT2, Der12

MMRRC Submission

042765-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.343) question?

Stock #

R5186 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

5024006-5031971 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 5028967 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 286 (R286Q)

Ref Sequence

ENSEMBL: ENSMUSP00000025826 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025826]

Predicted Effect

probably benign
Transcript: ENSMUST00000025826
AA Change: R286Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000025826
Gene: ENSMUSG00000024891
AA Change: R286Q

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
transmembrane domain	67	89	N/A	INTRINSIC
transmembrane domain	96	115	N/A	INTRINSIC
Pfam:Nucleoside_tran	130	454	3.7e-117	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The uptake of nucleosides by transporters, such as SLC29A2, is essential for nucleotide synthesis by salvage pathways in cells that lack de novo biosynthetic pathways. Nucleoside transport also plays a key role in the regulation of many physiologic processes through its effect on adenosine concentration at the cell surface (Griffiths et al., 1997 [PubMed 9396714]).[supplied by OMIM, Nov 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit normal adenosine uptake in erythrocytes and protection from acute lung injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	T	13: 59,743,739	L89H	probably damaging	Het
Abca8a	T	C	11: 110,091,599	I6V	probably null	Het
Aox1	A	G	1: 58,068,370	D601G	probably damaging	Het
Asic1	GCACC	GCACCACC	15: 99,698,803		probably benign	Het
Cacna1g	T	G	11: 94,442,848	N931T	probably damaging	Het
Ccdc14	T	C	16: 34,721,585	F511L	probably damaging	Het
Cd177	T	A	7: 24,744,923	E710V	probably benign	Het
Cep112	T	C	11: 108,752,560	C49R	probably benign	Het
Clip2	G	A	5: 134,522,791	T159M	possibly damaging	Het
Dnah2	T	C	11: 69,435,884	N3575S	probably damaging	Het
Dnah6	T	A	6: 73,067,427	I3234F	probably damaging	Het
Eci3	G	T	13: 34,946,978	A302E	possibly damaging	Het
Fam204a	T	C	19: 60,199,989	K214E	probably damaging	Het
Fam78a	T	C	2: 32,082,654	T85A	possibly damaging	Het
Flnb	T	C	14: 7,909,748	Y1401H	probably damaging	Het
Foxl2	A	T	9: 98,956,055	D132V	probably damaging	Het
Frs2	C	A	10: 117,078,842	W57C	probably damaging	Het
Gm26558	G	T	2: 70,661,417		probably benign	Het
Gpr139	A	G	7: 119,144,840	V174A	probably benign	Het
Grik5	T	C	7: 25,015,819	T676A	probably damaging	Het
H60c	T	C	10: 3,259,273		probably null	Het
Hspa1l	A	G	17: 34,978,469	K495E	probably damaging	Het
Irgm1	C	T	11: 48,866,217	V256I	probably benign	Het
Kat7	T	A	11: 95,286,416	T293S	probably benign	Het
Lipg	C	T	18: 74,960,938	V13I	probably benign	Het
Lrrn1	A	T	6: 107,569,224	Y661F	probably damaging	Het
Mllt3	A	G	4: 87,840,995	V272A	probably benign	Het
Mx1	G	A	16: 97,455,494	R162C	probably benign	Het
Myo18b	T	A	5: 112,871,470	D647V	probably damaging	Het
Naf1	G	A	8: 66,879,646	V329I	probably benign	Het
Olfr1286	A	T	2: 111,420,774	M59K	probably damaging	Het
Olfr654	A	T	7: 104,588,211	I153F	probably damaging	Het
Olfr936	A	T	9: 39,046,969	C194*	probably null	Het
P2rx5	G	A	11: 73,171,790	V442M	possibly damaging	Het
Pcdhb9	A	G	18: 37,401,232	E93G	probably damaging	Het
Pcdhga4	A	T	18: 37,687,426	N676I	probably benign	Het
Pgm5	A	G	19: 24,820,128	M230T	probably damaging	Het
Pik3c2g	T	C	6: 139,622,018	V44A	probably damaging	Het
Pp2d1	T	C	17: 53,508,140	M519V	probably benign	Het
Ppp1r10	A	G	17: 35,928,511	E404G	probably damaging	Het
Prpf8	A	T	11: 75,489,783	E104V	possibly damaging	Het
Ptpa	T	C	2: 30,438,355		probably null	Het
Pygl	A	C	12: 70,201,344	N248K	probably damaging	Het
Rbm8a	A	G	3: 96,630,932	D102G	probably damaging	Het
Sema3d	A	G	5: 12,584,908	D647G	probably benign	Het
Serpinb11	A	T	1: 107,379,754	D305V	probably damaging	Het
Slc12a8	T	C	16: 33,617,208	I337T	probably damaging	Het
Slc2a3	T	A	6: 122,735,583	D234V	probably damaging	Het
Slco4a1	T	C	2: 180,473,108	V608A	probably damaging	Het
Srrm2	C	T	17: 23,816,587	T831I	probably benign	Het
St18	T	A	1: 6,802,317		probably null	Het
Tesk2	G	C	4: 116,741,896	G67A	probably damaging	Het
Tlr1	A	T	5: 64,925,221	L671H	probably damaging	Het
Tmem63b	A	T	17: 45,661,477	Y735N	possibly damaging	Het
Tmprss11a	C	T	5: 86,420,079	C263Y	probably damaging	Het
Trio	A	T	15: 27,897,991	V345E	probably damaging	Het
Ubr5	A	G	15: 37,997,916	S1674P	probably damaging	Het
Uchl3	T	A	14: 101,695,917	C209S	probably damaging	Het
Uhmk1	T	C	1: 170,211,167	N206S	probably damaging	Het
Uhrf1	C	T	17: 56,318,340	R588W	probably damaging	Het
Usp28	T	C	9: 49,010,250	V256A	probably damaging	Het
Utrn	C	A	10: 12,728,777	L552F	probably damaging	Het
Vmn1r55	A	T	7: 5,146,986	M146K	probably damaging	Het
Vmn1r57	A	C	7: 5,221,108	I211L	probably benign	Het
Zar1	C	T	5: 72,577,399	C316Y	probably damaging	Het
Zc3h11a	A	T	1: 133,621,674	S750T	probably damaging	Het
Zcchc6	A	G	13: 59,816,656		probably null	Het
Zfp366	G	A	13: 99,246,168	C613Y	probably benign	Het
Zfp37	A	T	4: 62,191,256	C524S	probably damaging	Het
Zfp516	T	C	18: 82,957,093	V472A	probably benign	Het
Zhx1	A	T	15: 58,052,423	M809K	probably damaging	Het
Zic1	T	C	9: 91,364,371	Y216C	probably damaging	Het

Other mutations in Slc29a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01606:Slc29a2	APN	19	5027439	missense	possibly damaging	0.72
IGL01727:Slc29a2	APN	19	5026458	missense	probably damaging	0.98
IGL03268:Slc29a2	APN	19	5024503	splice site	probably benign
R4050:Slc29a2	UTSW	19	5029453	missense	possibly damaging	0.92
R4615:Slc29a2	UTSW	19	5029264	missense	probably damaging	0.98
R5450:Slc29a2	UTSW	19	5029275	missense	probably benign	0.24
R5512:Slc29a2	UTSW	19	5026398	missense	probably benign	0.03
R6461:Slc29a2	UTSW	19	5027740	missense	probably benign	0.03
R6809:Slc29a2	UTSW	19	5029243	missense	probably damaging	1.00
R7447:Slc29a2	UTSW	19	5026417	missense	probably damaging	1.00
R7671:Slc29a2	UTSW	19	5024262	missense	probably benign	0.15
R8427:Slc29a2	UTSW	19	5030420	missense	probably benign	0.22

Predicted Primers

PCR Primer
(F):5'- TCAACACTGAGGATTTCCGTAC -3'
(R):5'- CATGTTCATCATGCAGCCCC -3'

Sequencing Primer
(F):5'- CAACACTGAGGATTTCCGTACTTTTG -3'
(R):5'- TCATGCAGCCCCCACCC -3'

Posted On

2016-07-06