Incidental Mutation 'R5187:Fam129a'
ID397936
Institutional Source Beutler Lab
Gene Symbol Fam129a
Ensembl Gene ENSMUSG00000026483
Gene Namefamily with sequence similarity 129, member A
SynonymsNiban
MMRRC Submission 042766-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5187 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location151571186-151721939 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 151703829 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 433 (L433Q)
Ref Sequence ENSEMBL: ENSMUSP00000115822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097541] [ENSMUST00000148810]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000086267
Predicted Effect possibly damaging
Transcript: ENSMUST00000097541
AA Change: L433Q

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000095148
Gene: ENSMUSG00000026483
AA Change: L433Q

DomainStartEndE-ValueType
Blast:PH 70 197 2e-83 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000148810
AA Change: L433Q

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000115822
Gene: ENSMUSG00000026483
AA Change: L433Q

DomainStartEndE-ValueType
SCOP:d1faoa_ 67 118 1e-2 SMART
Blast:PH 70 197 1e-80 BLAST
low complexity region 540 549 N/A INTRINSIC
low complexity region 699 714 N/A INTRINSIC
low complexity region 784 797 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family with sequence similarity 129 protein family. This gene is highly expressed in several cancer cells and may serve as a prognostic marker for certain cancers. The encoded protein may play a role in regulating p53-mediated apoptosis. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable with no overt phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,718,809 L620* probably null Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abcg5 A G 17: 84,658,564 L628S probably damaging Het
Acbd3 C T 1: 180,736,732 R201* probably null Het
Adsl A G 15: 80,948,905 probably benign Het
Asic1 GCACC GCACCACC 15: 99,698,803 probably benign Het
Cachd1 T C 4: 100,966,200 V483A possibly damaging Het
Calm1 T C 12: 100,200,213 S19P probably benign Het
Casq1 T C 1: 172,213,074 N313S possibly damaging Het
Cav2 G T 6: 17,286,936 A64S possibly damaging Het
Ccdc114 A G 7: 45,929,116 I77V probably damaging Het
Ccdc167 C A 17: 29,705,511 A39S possibly damaging Het
Cd274 T C 19: 29,382,536 L247P probably benign Het
Cdhr5 T C 7: 141,274,448 E138G probably damaging Het
Cltb C T 13: 54,593,880 C81Y probably benign Het
Clvs1 T C 4: 9,281,865 L103P possibly damaging Het
Cntrob G T 11: 69,321,891 Q106K possibly damaging Het
Ctsh T C 9: 90,054,590 L14P probably damaging Het
Cubn T C 2: 13,287,568 N3268S probably damaging Het
Cyb5r4 T C 9: 87,026,948 V26A possibly damaging Het
Ddx18 A G 1: 121,562,128 I184T probably damaging Het
Ddx60 T A 8: 61,974,188 W766R probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnah5 G A 15: 28,272,172 V1041I probably benign Het
Dnajc21 A T 15: 10,463,964 N38K probably benign Het
Ermap T C 4: 119,185,818 probably null Het
Fryl A G 5: 73,086,600 L1209P possibly damaging Het
Gm5093 T C 17: 46,439,873 E76G possibly damaging Het
Grk6 T C 13: 55,451,706 C169R probably damaging Het
Hmgn1 A T 16: 96,122,427 probably null Het
Lpcat2b T A 5: 107,434,135 Y443* probably null Het
Macf1 T A 4: 123,472,089 M1395L probably benign Het
Mllt10 C T 2: 18,208,774 Q997* probably null Het
Mocos T A 18: 24,692,554 V722E probably damaging Het
Moxd2 A T 6: 40,879,337 L534M probably benign Het
Mphosph10 T C 7: 64,385,820 M368V possibly damaging Het
Myo15 G A 11: 60,503,614 G2383D probably damaging Het
Myo5b T C 18: 74,701,674 I935T possibly damaging Het
Ndst4 T A 3: 125,437,911 L43H probably damaging Het
Nsl1 A G 1: 191,075,190 N189D probably benign Het
Olfr558 A T 7: 102,709,661 H134L probably damaging Het
Pcdh8 T C 14: 79,770,154 D323G probably damaging Het
Pkhd1 A G 1: 20,209,224 S2957P possibly damaging Het
Prdm9 T G 17: 15,562,893 E42D probably damaging Het
Rasal1 C A 5: 120,675,395 H611Q probably benign Het
Rif1 T A 2: 52,081,289 W260R probably damaging Het
Rpain A G 11: 70,973,832 D115G probably benign Het
Rpl3l T C 17: 24,732,455 V110A possibly damaging Het
Ryr2 T A 13: 11,772,452 I1012F probably damaging Het
Sema4f A G 6: 82,917,650 V480A probably benign Het
Slc35a3 T A 3: 116,681,145 K199N probably damaging Het
Slc5a6 T C 5: 31,042,978 Y121C probably damaging Het
Slc7a14 T C 3: 31,237,365 probably null Het
Sort1 T A 3: 108,324,676 I172N probably damaging Het
Spink5 C A 18: 43,989,451 H328N probably damaging Het
Tbl1xr1 A G 3: 22,209,606 D504G probably damaging Het
Tcaf3 C T 6: 42,597,020 C86Y possibly damaging Het
Tfap2e T C 4: 126,734,641 D174G probably benign Het
Tmem42 T C 9: 123,022,167 V65A probably damaging Het
Vmn1r225 C G 17: 20,502,915 T206R probably damaging Het
Vmn2r38 A G 7: 9,097,572 F65S probably benign Het
Vmn2r87 A T 10: 130,497,339 L14Q probably null Het
Xirp2 T C 2: 67,515,367 S2651P probably benign Het
Zfp429 G A 13: 67,390,840 L162F probably damaging Het
Zhx1 A T 15: 58,052,423 M809K probably damaging Het
Other mutations in Fam129a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Fam129a APN 1 151717721 missense probably benign 0.06
IGL01690:Fam129a APN 1 151703804 missense probably damaging 1.00
IGL01762:Fam129a APN 1 151636491 missense probably damaging 1.00
IGL01784:Fam129a APN 1 151649365 missense probably damaging 1.00
IGL01938:Fam129a APN 1 151689614 missense probably benign 0.22
IGL02427:Fam129a APN 1 151717274 missense probably damaging 1.00
IGL02617:Fam129a APN 1 151571545 missense probably benign 0.11
IGL02946:Fam129a APN 1 151649425 missense probably damaging 0.99
R0242:Fam129a UTSW 1 151718216 missense probably benign 0.00
R0242:Fam129a UTSW 1 151718216 missense probably benign 0.00
R0279:Fam129a UTSW 1 151709206 critical splice donor site probably null
R0421:Fam129a UTSW 1 151709082 splice site probably benign
R0531:Fam129a UTSW 1 151718084 missense probably benign 0.11
R0725:Fam129a UTSW 1 151706015 missense probably benign 0.04
R1493:Fam129a UTSW 1 151706090 missense probably damaging 1.00
R1563:Fam129a UTSW 1 151715673 missense possibly damaging 0.69
R1868:Fam129a UTSW 1 151641551 missense possibly damaging 0.71
R1944:Fam129a UTSW 1 151696228 missense probably damaging 0.99
R1945:Fam129a UTSW 1 151696228 missense probably damaging 0.99
R2071:Fam129a UTSW 1 151636430 missense probably damaging 1.00
R2126:Fam129a UTSW 1 151696135 missense probably damaging 1.00
R2126:Fam129a UTSW 1 151709133 missense possibly damaging 0.94
R2138:Fam129a UTSW 1 151696251 missense probably damaging 0.98
R2180:Fam129a UTSW 1 151718078 missense probably benign 0.02
R2402:Fam129a UTSW 1 151689614 missense probably benign 0.22
R3689:Fam129a UTSW 1 151703696 splice site probably null
R3783:Fam129a UTSW 1 151689648 missense possibly damaging 0.66
R3975:Fam129a UTSW 1 151649335 missense probably damaging 1.00
R4029:Fam129a UTSW 1 151695690 missense probably benign 0.00
R4328:Fam129a UTSW 1 151636418 missense possibly damaging 0.86
R4447:Fam129a UTSW 1 151636402 critical splice acceptor site probably null
R4573:Fam129a UTSW 1 151703766 missense possibly damaging 0.85
R4774:Fam129a UTSW 1 151715694 missense probably damaging 1.00
R5064:Fam129a UTSW 1 151689659 missense probably benign 0.05
R5077:Fam129a UTSW 1 151714523 missense probably benign 0.00
R5484:Fam129a UTSW 1 151718086 missense probably benign 0.08
R5553:Fam129a UTSW 1 151717235 missense probably damaging 0.99
R5572:Fam129a UTSW 1 151709190 missense probably benign 0.05
R5575:Fam129a UTSW 1 151718240 missense probably benign 0.31
R5586:Fam129a UTSW 1 151717556 missense probably benign 0.00
R5697:Fam129a UTSW 1 151700261 missense probably damaging 1.00
R6305:Fam129a UTSW 1 151695718 missense probably damaging 1.00
R7065:Fam129a UTSW 1 151700107 critical splice acceptor site probably null
R7126:Fam129a UTSW 1 151714567 nonsense probably null
R7392:Fam129a UTSW 1 151696224 missense probably damaging 1.00
R7571:Fam129a UTSW 1 151718297 missense probably benign 0.01
R7577:Fam129a UTSW 1 151718312 missense probably benign
R7939:Fam129a UTSW 1 151706024 missense probably damaging 1.00
R8018:Fam129a UTSW 1 151717255 nonsense probably null
R8164:Fam129a UTSW 1 151717588 missense probably benign 0.02
R8356:Fam129a UTSW 1 151696150 missense probably damaging 1.00
R8478:Fam129a UTSW 1 151636512 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TCGGATAAAGTGGTCCAAGC -3'
(R):5'- CCTCACTTTCCTGAGCTGAAG -3'

Sequencing Primer
(F):5'- GCGTACACTTGATTGTTTCACAACAC -3'
(R):5'- GCTGAAGAGCACCATGGACAC -3'
Posted On2016-07-06