Incidental Mutation 'R5187:Mllt10'
ID397941
Institutional Source Beutler Lab
Gene Symbol Mllt10
Ensembl Gene ENSMUSG00000026743
Gene Namemyeloid/lymphoid or mixed-lineage leukemia; translocated to, 10
SynonymsAf10, D630001B22Rik, B130021D15Rik
MMRRC Submission 042766-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.678) question?
Stock #R5187 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location18055237-18212388 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 18208774 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 997 (Q997*)
Ref Sequence ENSEMBL: ENSMUSP00000110328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028076] [ENSMUST00000091418] [ENSMUST00000114669] [ENSMUST00000114671] [ENSMUST00000114680] [ENSMUST00000166495]
Predicted Effect probably null
Transcript: ENSMUST00000028076
AA Change: Q997*
SMART Domains Protein: ENSMUSP00000028076
Gene: ENSMUSG00000026743
AA Change: Q997*

DomainStartEndE-ValueType
PHD 24 72 8.51e-8 SMART
PHD 136 195 2.92e-6 SMART
low complexity region 217 248 N/A INTRINSIC
low complexity region 258 274 N/A INTRINSIC
low complexity region 308 326 N/A INTRINSIC
low complexity region 352 372 N/A INTRINSIC
low complexity region 490 515 N/A INTRINSIC
low complexity region 581 594 N/A INTRINSIC
low complexity region 609 627 N/A INTRINSIC
low complexity region 674 692 N/A INTRINSIC
coiled coil region 741 782 N/A INTRINSIC
low complexity region 836 879 N/A INTRINSIC
low complexity region 941 952 N/A INTRINSIC
low complexity region 966 986 N/A INTRINSIC
low complexity region 997 1018 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091418
SMART Domains Protein: ENSMUSP00000088980
Gene: ENSMUSG00000026740

DomainStartEndE-ValueType
signal peptide 1 43 N/A INTRINSIC
DnaJ 60 117 5.73e-23 SMART
transmembrane domain 149 171 N/A INTRINSIC
low complexity region 177 194 N/A INTRINSIC
low complexity region 269 281 N/A INTRINSIC
SANT 324 375 2.06e-6 SMART
low complexity region 416 434 N/A INTRINSIC
low complexity region 438 451 N/A INTRINSIC
SANT 491 543 3.56e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114669
AA Change: Q454*
SMART Domains Protein: ENSMUSP00000110317
Gene: ENSMUSG00000026743
AA Change: Q454*

DomainStartEndE-ValueType
low complexity region 38 51 N/A INTRINSIC
low complexity region 66 84 N/A INTRINSIC
low complexity region 131 149 N/A INTRINSIC
coiled coil region 198 239 N/A INTRINSIC
low complexity region 293 336 N/A INTRINSIC
low complexity region 398 409 N/A INTRINSIC
low complexity region 423 443 N/A INTRINSIC
low complexity region 454 475 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114671
AA Change: Q919*
SMART Domains Protein: ENSMUSP00000110319
Gene: ENSMUSG00000026743
AA Change: Q919*

DomainStartEndE-ValueType
PHD 58 117 2.92e-6 SMART
low complexity region 139 170 N/A INTRINSIC
low complexity region 180 196 N/A INTRINSIC
low complexity region 230 248 N/A INTRINSIC
low complexity region 274 294 N/A INTRINSIC
low complexity region 412 437 N/A INTRINSIC
low complexity region 503 516 N/A INTRINSIC
low complexity region 531 549 N/A INTRINSIC
low complexity region 596 614 N/A INTRINSIC
coiled coil region 663 704 N/A INTRINSIC
low complexity region 758 801 N/A INTRINSIC
low complexity region 863 874 N/A INTRINSIC
low complexity region 888 908 N/A INTRINSIC
low complexity region 919 940 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114680
AA Change: Q997*
SMART Domains Protein: ENSMUSP00000110328
Gene: ENSMUSG00000026743
AA Change: Q997*

DomainStartEndE-ValueType
PHD 24 72 8.51e-8 SMART
PHD 136 195 2.92e-6 SMART
low complexity region 217 248 N/A INTRINSIC
low complexity region 258 274 N/A INTRINSIC
low complexity region 308 326 N/A INTRINSIC
low complexity region 352 372 N/A INTRINSIC
low complexity region 490 515 N/A INTRINSIC
low complexity region 581 594 N/A INTRINSIC
low complexity region 609 627 N/A INTRINSIC
low complexity region 674 692 N/A INTRINSIC
coiled coil region 741 782 N/A INTRINSIC
low complexity region 836 879 N/A INTRINSIC
low complexity region 941 952 N/A INTRINSIC
low complexity region 966 986 N/A INTRINSIC
low complexity region 997 1018 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148401
SMART Domains Protein: ENSMUSP00000132289
Gene: ENSMUSG00000026740

DomainStartEndE-ValueType
SANT 2 49 1.74e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166495
SMART Domains Protein: ENSMUSP00000126321
Gene: ENSMUSG00000026740

DomainStartEndE-ValueType
signal peptide 1 43 N/A INTRINSIC
DnaJ 60 117 5.73e-23 SMART
transmembrane domain 149 171 N/A INTRINSIC
low complexity region 177 194 N/A INTRINSIC
low complexity region 269 281 N/A INTRINSIC
SANT 324 375 2.06e-6 SMART
low complexity region 416 434 N/A INTRINSIC
low complexity region 438 451 N/A INTRINSIC
SANT 491 543 3.56e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172210
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor and has been identified as a partner gene involved in several chromosomal rearrangements resulting in various leukemias. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,718,809 L620* probably null Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abcg5 A G 17: 84,658,564 L628S probably damaging Het
Acbd3 C T 1: 180,736,732 R201* probably null Het
Adsl A G 15: 80,948,905 probably benign Het
Asic1 GCACC GCACCACC 15: 99,698,803 probably benign Het
Cachd1 T C 4: 100,966,200 V483A possibly damaging Het
Calm1 T C 12: 100,200,213 S19P probably benign Het
Casq1 T C 1: 172,213,074 N313S possibly damaging Het
Cav2 G T 6: 17,286,936 A64S possibly damaging Het
Ccdc114 A G 7: 45,929,116 I77V probably damaging Het
Ccdc167 C A 17: 29,705,511 A39S possibly damaging Het
Cd274 T C 19: 29,382,536 L247P probably benign Het
Cdhr5 T C 7: 141,274,448 E138G probably damaging Het
Cltb C T 13: 54,593,880 C81Y probably benign Het
Clvs1 T C 4: 9,281,865 L103P possibly damaging Het
Cntrob G T 11: 69,321,891 Q106K possibly damaging Het
Ctsh T C 9: 90,054,590 L14P probably damaging Het
Cubn T C 2: 13,287,568 N3268S probably damaging Het
Cyb5r4 T C 9: 87,026,948 V26A possibly damaging Het
Ddx18 A G 1: 121,562,128 I184T probably damaging Het
Ddx60 T A 8: 61,974,188 W766R probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnah5 G A 15: 28,272,172 V1041I probably benign Het
Dnajc21 A T 15: 10,463,964 N38K probably benign Het
Ermap T C 4: 119,185,818 probably null Het
Fam129a T A 1: 151,703,829 L433Q possibly damaging Het
Fryl A G 5: 73,086,600 L1209P possibly damaging Het
Gm5093 T C 17: 46,439,873 E76G possibly damaging Het
Grk6 T C 13: 55,451,706 C169R probably damaging Het
Hmgn1 A T 16: 96,122,427 probably null Het
Lpcat2b T A 5: 107,434,135 Y443* probably null Het
Macf1 T A 4: 123,472,089 M1395L probably benign Het
Mocos T A 18: 24,692,554 V722E probably damaging Het
Moxd2 A T 6: 40,879,337 L534M probably benign Het
Mphosph10 T C 7: 64,385,820 M368V possibly damaging Het
Myo15 G A 11: 60,503,614 G2383D probably damaging Het
Myo5b T C 18: 74,701,674 I935T possibly damaging Het
Ndst4 T A 3: 125,437,911 L43H probably damaging Het
Nsl1 A G 1: 191,075,190 N189D probably benign Het
Olfr558 A T 7: 102,709,661 H134L probably damaging Het
Pcdh8 T C 14: 79,770,154 D323G probably damaging Het
Pkhd1 A G 1: 20,209,224 S2957P possibly damaging Het
Prdm9 T G 17: 15,562,893 E42D probably damaging Het
Rasal1 C A 5: 120,675,395 H611Q probably benign Het
Rif1 T A 2: 52,081,289 W260R probably damaging Het
Rpain A G 11: 70,973,832 D115G probably benign Het
Rpl3l T C 17: 24,732,455 V110A possibly damaging Het
Ryr2 T A 13: 11,772,452 I1012F probably damaging Het
Sema4f A G 6: 82,917,650 V480A probably benign Het
Slc35a3 T A 3: 116,681,145 K199N probably damaging Het
Slc5a6 T C 5: 31,042,978 Y121C probably damaging Het
Slc7a14 T C 3: 31,237,365 probably null Het
Sort1 T A 3: 108,324,676 I172N probably damaging Het
Spink5 C A 18: 43,989,451 H328N probably damaging Het
Tbl1xr1 A G 3: 22,209,606 D504G probably damaging Het
Tcaf3 C T 6: 42,597,020 C86Y possibly damaging Het
Tfap2e T C 4: 126,734,641 D174G probably benign Het
Tmem42 T C 9: 123,022,167 V65A probably damaging Het
Vmn1r225 C G 17: 20,502,915 T206R probably damaging Het
Vmn2r38 A G 7: 9,097,572 F65S probably benign Het
Vmn2r87 A T 10: 130,497,339 L14Q probably null Het
Xirp2 T C 2: 67,515,367 S2651P probably benign Het
Zfp429 G A 13: 67,390,840 L162F probably damaging Het
Zhx1 A T 15: 58,052,423 M809K probably damaging Het
Other mutations in Mllt10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01646:Mllt10 APN 2 18122317 missense probably damaging 1.00
IGL02366:Mllt10 APN 2 18065087 missense probably damaging 0.99
IGL02990:Mllt10 APN 2 18123711 splice site probably benign
IGL03034:Mllt10 APN 2 18065036 start codon destroyed probably null 0.55
R0348:Mllt10 UTSW 2 18162613 missense probably damaging 1.00
R0487:Mllt10 UTSW 2 18207137 missense probably damaging 0.98
R0492:Mllt10 UTSW 2 18146887 splice site probably benign
R0518:Mllt10 UTSW 2 18071206 critical splice donor site probably null
R0720:Mllt10 UTSW 2 18196595 missense probably benign
R0733:Mllt10 UTSW 2 18203766 intron probably benign
R1532:Mllt10 UTSW 2 18092835 critical splice donor site probably null
R1665:Mllt10 UTSW 2 18208790 missense possibly damaging 0.93
R1768:Mllt10 UTSW 2 18162846 missense probably damaging 1.00
R2098:Mllt10 UTSW 2 18162653 missense possibly damaging 0.50
R2114:Mllt10 UTSW 2 18162569 missense probably benign
R2116:Mllt10 UTSW 2 18162569 missense probably benign
R2117:Mllt10 UTSW 2 18162569 missense probably benign
R2179:Mllt10 UTSW 2 18210793 missense probably damaging 1.00
R2192:Mllt10 UTSW 2 18207060 missense probably benign 0.11
R2510:Mllt10 UTSW 2 18065124 missense possibly damaging 0.94
R2511:Mllt10 UTSW 2 18065124 missense possibly damaging 0.94
R4669:Mllt10 UTSW 2 18203633 missense probably damaging 1.00
R5004:Mllt10 UTSW 2 18170268 missense probably damaging 1.00
R5072:Mllt10 UTSW 2 18109874 missense possibly damaging 0.72
R5561:Mllt10 UTSW 2 18109845 missense probably damaging 0.98
R6141:Mllt10 UTSW 2 18210793 missense probably damaging 1.00
R6352:Mllt10 UTSW 2 18123793 missense probably damaging 1.00
R6844:Mllt10 UTSW 2 18159483 missense probably benign 0.02
R7060:Mllt10 UTSW 2 18159560 missense possibly damaging 0.64
R7464:Mllt10 UTSW 2 18170279 missense probably benign
R7691:Mllt10 UTSW 2 18203611 missense possibly damaging 0.94
R7691:Mllt10 UTSW 2 18203612 missense probably null 0.94
Z1177:Mllt10 UTSW 2 18171076 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCAGTTGCTTTCCTGGATGC -3'
(R):5'- ATACTTACTGTGACCTTCTGGC -3'

Sequencing Primer
(F):5'- AGTCTTGGCTAGCATGACAC -3'
(R):5'- ACTGTGACCTTCTGGCTCGTG -3'
Posted On2016-07-06