Mutagenetix > Incidental Mutation

Incidental Mutation 'R5187:Slc7a14'

397946

Institutional Source

Beutler Lab

Gene Symbol

Slc7a14

Ensembl Gene

ENSMUSG00000069072

Gene Name

solute carrier family 7 (cationic amino acid transporter, y+ system), member 14

Synonyms

MMRRC Submission

042766-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.212) question?

Stock #

R5187 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

31202858-31310378 bp(-) (GRCm38)

Type of Mutation

splice site (4 bp from exon)

DNA Base Change (assembly)

T to C at 31237365 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000103880 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091259] [ENSMUST00000108245]

AlphaFold

Q8BXR1

Predicted Effect

probably null
Transcript: ENSMUST00000091259

SMART Domains

Protein: ENSMUSP00000088803
Gene: ENSMUSG00000069072

Domain	Start	End	E-Value	Type
Pfam:AA_permease_2	53	443	2.1e-44	PFAM
Pfam:AA_permease	57	436	7.2e-38	PFAM
transmembrane domain	563	585	N/A	INTRINSIC
transmembrane domain	595	617	N/A	INTRINSIC
Pfam:AA_permease_C	627	677	9.2e-21	PFAM
low complexity region	737	757	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000108245

SMART Domains

Protein: ENSMUSP00000103880
Gene: ENSMUSG00000069072

Domain	Start	End	E-Value	Type
Pfam:AA_permease_2	53	445	2.5e-46	PFAM
Pfam:AA_permease	57	437	6.9e-41	PFAM
transmembrane domain	563	585	N/A	INTRINSIC
transmembrane domain	595	617	N/A	INTRINSIC
Pfam:AA_permease_C	627	668	1.4e-17	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predicted to encode a glycosylated, cationic amino acid transporter protein with 14 transmembrane domains. This gene is primarily expressed in skin fibroblasts, neural tissue, and primary endothelial cells and its protein is predicted to mediate lysosomal uptake of cationic amino acids. Mutations in this gene are associated with autosomal recessive retinitis pigmentosa. In mice, this gene is expressed in the photoreceptor layer of the retina where its expression increases over the course of retinal development and persists in the mature retina. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal eye electrophysiology, thin retinal outer nuclear and decreased total retinal thickness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	A	1: 105,718,809	L620*	probably null	Het
4930505A04Rik	C	T	11: 30,426,349	V173M	probably damaging	Het
Abcg5	A	G	17: 84,658,564	L628S	probably damaging	Het
Acbd3	C	T	1: 180,736,732	R201*	probably null	Het
Adsl	A	G	15: 80,948,905		probably benign	Het
Asic1	GCACC	GCACCACC	15: 99,698,803		probably benign	Het
Cachd1	T	C	4: 100,966,200	V483A	possibly damaging	Het
Calm1	T	C	12: 100,200,213	S19P	probably benign	Het
Casq1	T	C	1: 172,213,074	N313S	possibly damaging	Het
Cav2	G	T	6: 17,286,936	A64S	possibly damaging	Het
Ccdc114	A	G	7: 45,929,116	I77V	probably damaging	Het
Ccdc167	C	A	17: 29,705,511	A39S	possibly damaging	Het
Cd274	T	C	19: 29,382,536	L247P	probably benign	Het
Cdhr5	T	C	7: 141,274,448	E138G	probably damaging	Het
Cltb	C	T	13: 54,593,880	C81Y	probably benign	Het
Clvs1	T	C	4: 9,281,865	L103P	possibly damaging	Het
Cntrob	G	T	11: 69,321,891	Q106K	possibly damaging	Het
Ctsh	T	C	9: 90,054,590	L14P	probably damaging	Het
Cubn	T	C	2: 13,287,568	N3268S	probably damaging	Het
Cyb5r4	T	C	9: 87,026,948	V26A	possibly damaging	Het
Ddx18	A	G	1: 121,562,128	I184T	probably damaging	Het
Ddx60	T	A	8: 61,974,188	W766R	probably damaging	Het
Dnah2	C	T	11: 69,458,920	R2399Q	probably benign	Het
Dnah5	G	A	15: 28,272,172	V1041I	probably benign	Het
Dnajc21	A	T	15: 10,463,964	N38K	probably benign	Het
Ermap	T	C	4: 119,185,818		probably null	Het
Fam129a	T	A	1: 151,703,829	L433Q	possibly damaging	Het
Fryl	A	G	5: 73,086,600	L1209P	possibly damaging	Het
Gm5093	T	C	17: 46,439,873	E76G	possibly damaging	Het
Grk6	T	C	13: 55,451,706	C169R	probably damaging	Het
Hmgn1	A	T	16: 96,122,427		probably null	Het
Lpcat2b	T	A	5: 107,434,135	Y443*	probably null	Het
Macf1	T	A	4: 123,472,089	M1395L	probably benign	Het
Mllt10	C	T	2: 18,208,774	Q997*	probably null	Het
Mocos	T	A	18: 24,692,554	V722E	probably damaging	Het
Moxd2	A	T	6: 40,879,337	L534M	probably benign	Het
Mphosph10	T	C	7: 64,385,820	M368V	possibly damaging	Het
Myo15	G	A	11: 60,503,614	G2383D	probably damaging	Het
Myo5b	T	C	18: 74,701,674	I935T	possibly damaging	Het
Ndst4	T	A	3: 125,437,911	L43H	probably damaging	Het
Nsl1	A	G	1: 191,075,190	N189D	probably benign	Het
Olfr558	A	T	7: 102,709,661	H134L	probably damaging	Het
Pcdh8	T	C	14: 79,770,154	D323G	probably damaging	Het
Pkhd1	A	G	1: 20,209,224	S2957P	possibly damaging	Het
Prdm9	T	G	17: 15,562,893	E42D	probably damaging	Het
Rasal1	C	A	5: 120,675,395	H611Q	probably benign	Het
Rif1	T	A	2: 52,081,289	W260R	probably damaging	Het
Rpain	A	G	11: 70,973,832	D115G	probably benign	Het
Rpl3l	T	C	17: 24,732,455	V110A	possibly damaging	Het
Ryr2	T	A	13: 11,772,452	I1012F	probably damaging	Het
Sema4f	A	G	6: 82,917,650	V480A	probably benign	Het
Slc35a3	T	A	3: 116,681,145	K199N	probably damaging	Het
Slc5a6	T	C	5: 31,042,978	Y121C	probably damaging	Het
Sort1	T	A	3: 108,324,676	I172N	probably damaging	Het
Spink5	C	A	18: 43,989,451	H328N	probably damaging	Het
Tbl1xr1	A	G	3: 22,209,606	D504G	probably damaging	Het
Tcaf3	C	T	6: 42,597,020	C86Y	possibly damaging	Het
Tfap2e	T	C	4: 126,734,641	D174G	probably benign	Het
Tmem42	T	C	9: 123,022,167	V65A	probably damaging	Het
Vmn1r225	C	G	17: 20,502,915	T206R	probably damaging	Het
Vmn2r38	A	G	7: 9,097,572	F65S	probably benign	Het
Vmn2r87	A	T	10: 130,497,339	L14Q	probably null	Het
Xirp2	T	C	2: 67,515,367	S2651P	probably benign	Het
Zfp429	G	A	13: 67,390,840	L162F	probably damaging	Het
Zhx1	A	T	15: 58,052,423	M809K	probably damaging	Het

Other mutations in Slc7a14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02631:Slc7a14	APN	3	31238678	missense	probably damaging	1.00
IGL02713:Slc7a14	APN	3	31257763	missense	probably damaging	0.96
IGL03341:Slc7a14	APN	3	31238770	missense	probably damaging	1.00
IGL03350:Slc7a14	APN	3	31237409	missense	probably benign	0.35
IGL03379:Slc7a14	APN	3	31223515	missense	probably damaging	1.00
R0064:Slc7a14	UTSW	3	31227060	missense	probably damaging	1.00
R1549:Slc7a14	UTSW	3	31224118	missense	possibly damaging	0.94
R1591:Slc7a14	UTSW	3	31237449	missense	probably damaging	1.00
R2054:Slc7a14	UTSW	3	31237362	splice site	probably benign
R2057:Slc7a14	UTSW	3	31237496	missense	probably damaging	1.00
R2442:Slc7a14	UTSW	3	31230320	missense	probably damaging	1.00
R2504:Slc7a14	UTSW	3	31237501	missense	possibly damaging	0.85
R3848:Slc7a14	UTSW	3	31237474	missense	probably damaging	1.00
R4653:Slc7a14	UTSW	3	31257682	missense	probably damaging	1.00
R4702:Slc7a14	UTSW	3	31230398	missense	probably damaging	1.00
R5043:Slc7a14	UTSW	3	31237466	missense	probably damaging	1.00
R5345:Slc7a14	UTSW	3	31223857	missense	probably damaging	0.99
R5393:Slc7a14	UTSW	3	31257770	missense	probably damaging	1.00
R5421:Slc7a14	UTSW	3	31224197	missense	probably damaging	1.00
R5736:Slc7a14	UTSW	3	31223910	missense	probably benign	0.00
R5771:Slc7a14	UTSW	3	31238707	missense	probably damaging	1.00
R5896:Slc7a14	UTSW	3	31257570	missense	probably damaging	1.00
R5996:Slc7a14	UTSW	3	31209236	missense	probably benign
R6020:Slc7a14	UTSW	3	31224112	missense	probably benign
R6107:Slc7a14	UTSW	3	31257610	missense	probably damaging	1.00
R6140:Slc7a14	UTSW	3	31237548	missense	probably benign
R6491:Slc7a14	UTSW	3	31223944	missense	probably damaging	1.00
R6846:Slc7a14	UTSW	3	31224223	missense	probably damaging	1.00
R6990:Slc7a14	UTSW	3	31223579	missense	possibly damaging	0.90
R7184:Slc7a14	UTSW	3	31227063	missense	probably damaging	0.98
R7271:Slc7a14	UTSW	3	31224235	missense	probably damaging	1.00
R7282:Slc7a14	UTSW	3	31227153	missense	possibly damaging	0.67
R7331:Slc7a14	UTSW	3	31257731	missense	probably benign	0.00
R8227:Slc7a14	UTSW	3	31209212	missense	probably benign	0.00
R8238:Slc7a14	UTSW	3	31227151	missense	probably benign	0.01
R8524:Slc7a14	UTSW	3	31224133	missense	possibly damaging	0.70
R8843:Slc7a14	UTSW	3	31257610	missense	probably damaging	1.00
R8903:Slc7a14	UTSW	3	31223446	missense	probably damaging	0.98
R9011:Slc7a14	UTSW	3	31224196	missense	probably damaging	1.00
R9208:Slc7a14	UTSW	3	31227210	missense	probably damaging	1.00
R9633:Slc7a14	UTSW	3	31224017	missense	probably benign	0.31
Z1088:Slc7a14	UTSW	3	31223999	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- TGCTGTCATTGCTACCTGTG -3'
(R):5'- GGATGGGTCCACCTTCTTTAG -3'

Sequencing Primer
(F):5'- TCATTGCTACCTGTGTGGAC -3'
(R):5'- GAAGAGTCGTACCCAGACCTTCTG -3'

Posted On

2016-07-06