Incidental Mutation 'R5187:Slc35a3'
ID397948
Institutional Source Beutler Lab
Gene Symbol Slc35a3
Ensembl Gene ENSMUSG00000027957
Gene Namesolute carrier family 35 (UDP-N-acetylglucosamine (UDP-GlcNAc) transporter), member 3
Synonyms2310050P13Rik
MMRRC Submission 042766-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R5187 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location116669470-116712831 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116681145 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 199 (K199N)
Ref Sequence ENSEMBL: ENSMUSP00000123641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029569] [ENSMUST00000120120] [ENSMUST00000153108] [ENSMUST00000196335]
Predicted Effect probably damaging
Transcript: ENSMUST00000029569
AA Change: K199N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029569
Gene: ENSMUSG00000027957
AA Change: K199N

DomainStartEndE-ValueType
Pfam:Nuc_sug_transp 1 314 2.3e-141 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120120
AA Change: K199N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112674
Gene: ENSMUSG00000027957
AA Change: K199N

DomainStartEndE-ValueType
Pfam:UAA 13 320 1.4e-11 PFAM
Pfam:EamA 29 156 2.1e-8 PFAM
Pfam:TPT 38 154 1.2e-7 PFAM
Pfam:Nuc_sug_transp 68 306 6.3e-105 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000140672
AA Change: K38N
SMART Domains Protein: ENSMUSP00000114952
Gene: ENSMUSG00000105103
AA Change: K38N

DomainStartEndE-ValueType
Pfam:Nuc_sug_transp 2 129 2.4e-39 PFAM
Pfam:MFS_1 104 235 1e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000153108
AA Change: K199N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123641
Gene: ENSMUSG00000027957
AA Change: K199N

DomainStartEndE-ValueType
Pfam:UAA 10 209 1.6e-10 PFAM
Pfam:EamA 27 156 6.2e-9 PFAM
Pfam:TPT 37 154 3.2e-8 PFAM
Pfam:Nuc_sug_transp 68 212 1.6e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196331
Predicted Effect probably benign
Transcript: ENSMUST00000196335
SMART Domains Protein: ENSMUSP00000142374
Gene: ENSMUSG00000027957

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:EamA 29 156 6.8e-7 PFAM
Pfam:TPT 34 154 1.6e-6 PFAM
Pfam:Nuc_sug_transp 68 167 5.9e-40 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a UDP-N-acetylglucosamine transporter found in the golgi apparatus membrane. In cattle, a missense mutation in this gene causes complex vertebral malformation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,718,809 L620* probably null Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abcg5 A G 17: 84,658,564 L628S probably damaging Het
Acbd3 C T 1: 180,736,732 R201* probably null Het
Adsl A G 15: 80,948,905 probably benign Het
Asic1 GCACC GCACCACC 15: 99,698,803 probably benign Het
Cachd1 T C 4: 100,966,200 V483A possibly damaging Het
Calm1 T C 12: 100,200,213 S19P probably benign Het
Casq1 T C 1: 172,213,074 N313S possibly damaging Het
Cav2 G T 6: 17,286,936 A64S possibly damaging Het
Ccdc114 A G 7: 45,929,116 I77V probably damaging Het
Ccdc167 C A 17: 29,705,511 A39S possibly damaging Het
Cd274 T C 19: 29,382,536 L247P probably benign Het
Cdhr5 T C 7: 141,274,448 E138G probably damaging Het
Cltb C T 13: 54,593,880 C81Y probably benign Het
Clvs1 T C 4: 9,281,865 L103P possibly damaging Het
Cntrob G T 11: 69,321,891 Q106K possibly damaging Het
Ctsh T C 9: 90,054,590 L14P probably damaging Het
Cubn T C 2: 13,287,568 N3268S probably damaging Het
Cyb5r4 T C 9: 87,026,948 V26A possibly damaging Het
Ddx18 A G 1: 121,562,128 I184T probably damaging Het
Ddx60 T A 8: 61,974,188 W766R probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnah5 G A 15: 28,272,172 V1041I probably benign Het
Dnajc21 A T 15: 10,463,964 N38K probably benign Het
Ermap T C 4: 119,185,818 probably null Het
Fam129a T A 1: 151,703,829 L433Q possibly damaging Het
Fryl A G 5: 73,086,600 L1209P possibly damaging Het
Gm5093 T C 17: 46,439,873 E76G possibly damaging Het
Grk6 T C 13: 55,451,706 C169R probably damaging Het
Hmgn1 A T 16: 96,122,427 probably null Het
Lpcat2b T A 5: 107,434,135 Y443* probably null Het
Macf1 T A 4: 123,472,089 M1395L probably benign Het
Mllt10 C T 2: 18,208,774 Q997* probably null Het
Mocos T A 18: 24,692,554 V722E probably damaging Het
Moxd2 A T 6: 40,879,337 L534M probably benign Het
Mphosph10 T C 7: 64,385,820 M368V possibly damaging Het
Myo15 G A 11: 60,503,614 G2383D probably damaging Het
Myo5b T C 18: 74,701,674 I935T possibly damaging Het
Ndst4 T A 3: 125,437,911 L43H probably damaging Het
Nsl1 A G 1: 191,075,190 N189D probably benign Het
Olfr558 A T 7: 102,709,661 H134L probably damaging Het
Pcdh8 T C 14: 79,770,154 D323G probably damaging Het
Pkhd1 A G 1: 20,209,224 S2957P possibly damaging Het
Prdm9 T G 17: 15,562,893 E42D probably damaging Het
Rasal1 C A 5: 120,675,395 H611Q probably benign Het
Rif1 T A 2: 52,081,289 W260R probably damaging Het
Rpain A G 11: 70,973,832 D115G probably benign Het
Rpl3l T C 17: 24,732,455 V110A possibly damaging Het
Ryr2 T A 13: 11,772,452 I1012F probably damaging Het
Sema4f A G 6: 82,917,650 V480A probably benign Het
Slc5a6 T C 5: 31,042,978 Y121C probably damaging Het
Slc7a14 T C 3: 31,237,365 probably null Het
Sort1 T A 3: 108,324,676 I172N probably damaging Het
Spink5 C A 18: 43,989,451 H328N probably damaging Het
Tbl1xr1 A G 3: 22,209,606 D504G probably damaging Het
Tcaf3 C T 6: 42,597,020 C86Y possibly damaging Het
Tfap2e T C 4: 126,734,641 D174G probably benign Het
Tmem42 T C 9: 123,022,167 V65A probably damaging Het
Vmn1r225 C G 17: 20,502,915 T206R probably damaging Het
Vmn2r38 A G 7: 9,097,572 F65S probably benign Het
Vmn2r87 A T 10: 130,497,339 L14Q probably null Het
Xirp2 T C 2: 67,515,367 S2651P probably benign Het
Zfp429 G A 13: 67,390,840 L162F probably damaging Het
Zhx1 A T 15: 58,052,423 M809K probably damaging Het
Other mutations in Slc35a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Slc35a3 APN 3 116694613 missense probably damaging 1.00
IGL02092:Slc35a3 APN 3 116681132 missense probably damaging 1.00
IGL02424:Slc35a3 APN 3 116694618 missense possibly damaging 0.92
IGL03304:Slc35a3 APN 3 116687311 missense probably damaging 1.00
R1465:Slc35a3 UTSW 3 116687334 missense probably benign 0.44
R1465:Slc35a3 UTSW 3 116687334 missense probably benign 0.44
R1753:Slc35a3 UTSW 3 116677948 missense possibly damaging 0.79
R2035:Slc35a3 UTSW 3 116687323 missense probably damaging 1.00
R2265:Slc35a3 UTSW 3 116673636 missense possibly damaging 0.87
R2266:Slc35a3 UTSW 3 116673636 missense possibly damaging 0.87
R2267:Slc35a3 UTSW 3 116673636 missense possibly damaging 0.87
R2268:Slc35a3 UTSW 3 116673636 missense possibly damaging 0.87
R4073:Slc35a3 UTSW 3 116675238 missense probably benign 0.05
R5490:Slc35a3 UTSW 3 116681190 nonsense probably null
R6841:Slc35a3 UTSW 3 116712768 missense probably null
R7270:Slc35a3 UTSW 3 116711806 intron probably benign
Predicted Primers PCR Primer
(F):5'- CTGAAAGACTTAGGGAGATCCAC -3'
(R):5'- GGTAGCTTACCTTCTGCTCAGG -3'

Sequencing Primer
(F):5'- TTTAAGATGCGGTCTCCCTATG -3'
(R):5'- CACAGACTCAGGTTGTCAATCTTGG -3'
Posted On2016-07-06