Incidental Mutation 'R5187:Tcaf3'
ID 397961
Institutional Source Beutler Lab
Gene Symbol Tcaf3
Ensembl Gene ENSMUSG00000018656
Gene Name TRPM8 channel-associated factor 3
Synonyms Eapa2, Fam115e
MMRRC Submission 042766-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.050) question?
Stock # R5187 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 42564147-42574306 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 42573954 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 86 (C86Y)
Ref Sequence ENSEMBL: ENSMUSP00000064060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069023] [ENSMUST00000134707]
AlphaFold Q6QR59
Predicted Effect possibly damaging
Transcript: ENSMUST00000069023
AA Change: C86Y

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000064060
Gene: ENSMUSG00000018656
AA Change: C86Y

DomainStartEndE-ValueType
internal_repeat_1 26 194 9.98e-16 PROSPERO
low complexity region 210 221 N/A INTRINSIC
internal_repeat_1 234 402 9.98e-16 PROSPERO
low complexity region 509 518 N/A INTRINSIC
M60-like 533 832 3.49e-130 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134707
AA Change: C86Y

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000123321
Gene: ENSMUSG00000018656
AA Change: C86Y

DomainStartEndE-ValueType
low complexity region 210 221 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,376,349 (GRCm39) V173M probably damaging Het
Abcg5 A G 17: 84,965,992 (GRCm39) L628S probably damaging Het
Acbd3 C T 1: 180,564,297 (GRCm39) R201* probably null Het
Adsl A G 15: 80,833,106 (GRCm39) probably benign Het
Asic1 GCACC GCACCACC 15: 99,596,684 (GRCm39) probably benign Het
Cachd1 T C 4: 100,823,397 (GRCm39) V483A possibly damaging Het
Calm1 T C 12: 100,166,472 (GRCm39) S19P probably benign Het
Casq1 T C 1: 172,040,641 (GRCm39) N313S possibly damaging Het
Cav2 G T 6: 17,286,935 (GRCm39) A64S possibly damaging Het
Ccdc167 C A 17: 29,924,485 (GRCm39) A39S possibly damaging Het
Cd274 T C 19: 29,359,936 (GRCm39) L247P probably benign Het
Cdhr5 T C 7: 140,854,361 (GRCm39) E138G probably damaging Het
Cltb C T 13: 54,741,693 (GRCm39) C81Y probably benign Het
Clvs1 T C 4: 9,281,865 (GRCm39) L103P possibly damaging Het
Cntrob G T 11: 69,212,717 (GRCm39) Q106K possibly damaging Het
Ctsh T C 9: 89,936,643 (GRCm39) L14P probably damaging Het
Cubn T C 2: 13,292,379 (GRCm39) N3268S probably damaging Het
Cyb5r4 T C 9: 86,909,001 (GRCm39) V26A possibly damaging Het
Ddx18 A G 1: 121,489,857 (GRCm39) I184T probably damaging Het
Ddx60 T A 8: 62,427,222 (GRCm39) W766R probably damaging Het
Dnah2 C T 11: 69,349,746 (GRCm39) R2399Q probably benign Het
Dnah5 G A 15: 28,272,318 (GRCm39) V1041I probably benign Het
Dnajc21 A T 15: 10,464,050 (GRCm39) N38K probably benign Het
Ermap T C 4: 119,043,015 (GRCm39) probably null Het
Fryl A G 5: 73,243,943 (GRCm39) L1209P possibly damaging Het
Gm5093 T C 17: 46,750,799 (GRCm39) E76G possibly damaging Het
Grk6 T C 13: 55,599,519 (GRCm39) C169R probably damaging Het
Hmgn1 A T 16: 95,923,627 (GRCm39) probably null Het
Lpcat2b T A 5: 107,582,001 (GRCm39) Y443* probably null Het
Macf1 T A 4: 123,365,882 (GRCm39) M1395L probably benign Het
Mllt10 C T 2: 18,213,585 (GRCm39) Q997* probably null Het
Mocos T A 18: 24,825,611 (GRCm39) V722E probably damaging Het
Moxd2 A T 6: 40,856,271 (GRCm39) L534M probably benign Het
Mphosph10 T C 7: 64,035,568 (GRCm39) M368V possibly damaging Het
Myo15a G A 11: 60,394,440 (GRCm39) G2383D probably damaging Het
Myo5b T C 18: 74,834,745 (GRCm39) I935T possibly damaging Het
Ndst4 T A 3: 125,231,560 (GRCm39) L43H probably damaging Het
Niban1 T A 1: 151,579,580 (GRCm39) L433Q possibly damaging Het
Nsl1 A G 1: 190,807,387 (GRCm39) N189D probably benign Het
Odad1 A G 7: 45,578,540 (GRCm39) I77V probably damaging Het
Or51e1 A T 7: 102,358,868 (GRCm39) H134L probably damaging Het
Pcdh8 T C 14: 80,007,594 (GRCm39) D323G probably damaging Het
Pkhd1 A G 1: 20,279,448 (GRCm39) S2957P possibly damaging Het
Prdm9 T G 17: 15,783,155 (GRCm39) E42D probably damaging Het
Rasal1 C A 5: 120,813,460 (GRCm39) H611Q probably benign Het
Relch T A 1: 105,646,534 (GRCm39) L620* probably null Het
Rif1 T A 2: 51,971,301 (GRCm39) W260R probably damaging Het
Rpain A G 11: 70,864,658 (GRCm39) D115G probably benign Het
Rpl3l T C 17: 24,951,429 (GRCm39) V110A possibly damaging Het
Ryr2 T A 13: 11,787,338 (GRCm39) I1012F probably damaging Het
Sema4f A G 6: 82,894,631 (GRCm39) V480A probably benign Het
Slc35a3 T A 3: 116,474,794 (GRCm39) K199N probably damaging Het
Slc5a6 T C 5: 31,200,322 (GRCm39) Y121C probably damaging Het
Slc7a14 T C 3: 31,291,514 (GRCm39) probably null Het
Sort1 T A 3: 108,231,992 (GRCm39) I172N probably damaging Het
Spink5 C A 18: 44,122,518 (GRCm39) H328N probably damaging Het
Tbl1xr1 A G 3: 22,263,770 (GRCm39) D504G probably damaging Het
Tfap2e T C 4: 126,628,434 (GRCm39) D174G probably benign Het
Tmem42 T C 9: 122,851,232 (GRCm39) V65A probably damaging Het
Vmn1r225 C G 17: 20,723,177 (GRCm39) T206R probably damaging Het
Vmn2r38 A G 7: 9,100,571 (GRCm39) F65S probably benign Het
Vmn2r87 A T 10: 130,333,208 (GRCm39) L14Q probably null Het
Xirp2 T C 2: 67,345,711 (GRCm39) S2651P probably benign Het
Zfp429 G A 13: 67,538,959 (GRCm39) L162F probably damaging Het
Zhx1 A T 15: 57,915,819 (GRCm39) M809K probably damaging Het
Other mutations in Tcaf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Tcaf3 APN 6 42,570,319 (GRCm39) missense probably benign 0.14
IGL00931:Tcaf3 APN 6 42,574,162 (GRCm39) missense probably benign 0.16
IGL01391:Tcaf3 APN 6 42,570,615 (GRCm39) missense probably damaging 1.00
IGL01804:Tcaf3 APN 6 42,574,063 (GRCm39) missense probably damaging 1.00
IGL02272:Tcaf3 APN 6 42,573,594 (GRCm39) missense probably damaging 0.98
IGL02934:Tcaf3 APN 6 42,570,832 (GRCm39) missense probably benign 0.00
IGL03258:Tcaf3 APN 6 42,566,773 (GRCm39) missense probably damaging 1.00
defused UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R0116:Tcaf3 UTSW 6 42,568,284 (GRCm39) missense probably benign 0.12
R0135:Tcaf3 UTSW 6 42,566,692 (GRCm39) missense probably benign
R0357:Tcaf3 UTSW 6 42,566,761 (GRCm39) missense probably damaging 0.98
R0526:Tcaf3 UTSW 6 42,566,738 (GRCm39) missense probably damaging 1.00
R0592:Tcaf3 UTSW 6 42,573,777 (GRCm39) missense probably benign 0.16
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1902:Tcaf3 UTSW 6 42,570,486 (GRCm39) missense possibly damaging 0.83
R1912:Tcaf3 UTSW 6 42,573,622 (GRCm39) missense possibly damaging 0.59
R2020:Tcaf3 UTSW 6 42,570,658 (GRCm39) missense possibly damaging 0.66
R2238:Tcaf3 UTSW 6 42,570,262 (GRCm39) missense probably benign 0.00
R2259:Tcaf3 UTSW 6 42,568,364 (GRCm39) missense possibly damaging 0.53
R2436:Tcaf3 UTSW 6 42,570,663 (GRCm39) missense probably damaging 1.00
R3005:Tcaf3 UTSW 6 42,570,978 (GRCm39) missense probably damaging 1.00
R3402:Tcaf3 UTSW 6 42,570,787 (GRCm39) missense probably benign 0.08
R3753:Tcaf3 UTSW 6 42,566,738 (GRCm39) missense probably damaging 1.00
R3799:Tcaf3 UTSW 6 42,574,014 (GRCm39) missense probably damaging 1.00
R4515:Tcaf3 UTSW 6 42,566,930 (GRCm39) missense probably damaging 1.00
R4640:Tcaf3 UTSW 6 42,564,513 (GRCm39) missense probably damaging 0.96
R4688:Tcaf3 UTSW 6 42,570,300 (GRCm39) splice site probably null
R4904:Tcaf3 UTSW 6 42,570,931 (GRCm39) nonsense probably null
R5030:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5031:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5045:Tcaf3 UTSW 6 42,570,618 (GRCm39) missense possibly damaging 0.55
R5105:Tcaf3 UTSW 6 42,568,259 (GRCm39) missense probably damaging 1.00
R5139:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5196:Tcaf3 UTSW 6 42,570,649 (GRCm39) missense probably benign 0.00
R5213:Tcaf3 UTSW 6 42,568,401 (GRCm39) missense probably damaging 1.00
R5296:Tcaf3 UTSW 6 42,564,444 (GRCm39) missense possibly damaging 0.55
R5402:Tcaf3 UTSW 6 42,568,860 (GRCm39) missense probably benign 0.12
R5425:Tcaf3 UTSW 6 42,573,697 (GRCm39) missense probably damaging 1.00
R5431:Tcaf3 UTSW 6 42,574,119 (GRCm39) missense probably damaging 1.00
R5601:Tcaf3 UTSW 6 42,564,462 (GRCm39) missense possibly damaging 0.90
R5839:Tcaf3 UTSW 6 42,570,783 (GRCm39) missense possibly damaging 0.55
R5865:Tcaf3 UTSW 6 42,573,631 (GRCm39) missense probably benign 0.07
R6005:Tcaf3 UTSW 6 42,566,905 (GRCm39) missense probably benign 0.19
R6270:Tcaf3 UTSW 6 42,570,725 (GRCm39) missense probably benign 0.00
R6341:Tcaf3 UTSW 6 42,574,193 (GRCm39) missense possibly damaging 0.55
R6344:Tcaf3 UTSW 6 42,574,105 (GRCm39) missense possibly damaging 0.48
R6521:Tcaf3 UTSW 6 42,570,172 (GRCm39) missense probably damaging 0.99
R6589:Tcaf3 UTSW 6 42,570,995 (GRCm39) missense possibly damaging 0.55
R6981:Tcaf3 UTSW 6 42,574,059 (GRCm39) missense probably damaging 1.00
R7155:Tcaf3 UTSW 6 42,570,825 (GRCm39) missense probably benign
R7185:Tcaf3 UTSW 6 42,570,864 (GRCm39) missense probably benign 0.01
R7262:Tcaf3 UTSW 6 42,570,735 (GRCm39) missense probably damaging 0.97
R7340:Tcaf3 UTSW 6 42,566,848 (GRCm39) missense probably benign 0.08
R7421:Tcaf3 UTSW 6 42,573,776 (GRCm39) missense probably benign 0.02
R7690:Tcaf3 UTSW 6 42,574,069 (GRCm39) missense probably damaging 1.00
R7850:Tcaf3 UTSW 6 42,571,140 (GRCm39) splice site probably null
R7909:Tcaf3 UTSW 6 42,568,898 (GRCm39) missense possibly damaging 0.92
R9419:Tcaf3 UTSW 6 42,573,716 (GRCm39) missense probably benign 0.00
R9440:Tcaf3 UTSW 6 42,573,906 (GRCm39) nonsense probably null
R9469:Tcaf3 UTSW 6 42,573,828 (GRCm39) missense probably benign 0.00
R9668:Tcaf3 UTSW 6 42,566,636 (GRCm39) missense probably damaging 1.00
R9787:Tcaf3 UTSW 6 42,574,024 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTGAGCAGCCCAATTCAAAG -3'
(R):5'- CAGTGAACTTCTCCTTACTGGGG -3'

Sequencing Primer
(F):5'- CTCCATTCTTCAGGAATTGGATCAG -3'
(R):5'- CTTACTGGGGAGTCAGCCTTC -3'
Posted On 2016-07-06