Mutagenetix > Incidental Mutation

Incidental Mutation 'R5187:Tcaf3'

397961

Institutional Source

Beutler Lab

Gene Symbol

Tcaf3

Ensembl Gene

ENSMUSG00000018656

Gene Name

TRPM8 channel-associated factor 3

Synonyms

Eapa2, Fam115e

MMRRC Submission

042766-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.051) question?

Stock #

R5187 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

42584866-42597692 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 42597020 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 86 (C86Y)

Ref Sequence

ENSEMBL: ENSMUSP00000064060 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069023] [ENSMUST00000134707]

AlphaFold

Q6QR59

Predicted Effect

possibly damaging
Transcript: ENSMUST00000069023
AA Change: C86Y

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000064060
Gene: ENSMUSG00000018656
AA Change: C86Y

Domain	Start	End	E-Value	Type
internal_repeat_1	26	194	9.98e-16	PROSPERO
low complexity region	210	221	N/A	INTRINSIC
internal_repeat_1	234	402	9.98e-16	PROSPERO
low complexity region	509	518	N/A	INTRINSIC
M60-like	533	832	3.49e-130	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000134707
AA Change: C86Y

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000123321
Gene: ENSMUSG00000018656
AA Change: C86Y

Domain	Start	End	E-Value	Type
low complexity region	210	221	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	A	1: 105,718,809	L620*	probably null	Het
4930505A04Rik	C	T	11: 30,426,349	V173M	probably damaging	Het
Abcg5	A	G	17: 84,658,564	L628S	probably damaging	Het
Acbd3	C	T	1: 180,736,732	R201*	probably null	Het
Adsl	A	G	15: 80,948,905		probably benign	Het
Asic1	GCACC	GCACCACC	15: 99,698,803		probably benign	Het
Cachd1	T	C	4: 100,966,200	V483A	possibly damaging	Het
Calm1	T	C	12: 100,200,213	S19P	probably benign	Het
Casq1	T	C	1: 172,213,074	N313S	possibly damaging	Het
Cav2	G	T	6: 17,286,936	A64S	possibly damaging	Het
Ccdc114	A	G	7: 45,929,116	I77V	probably damaging	Het
Ccdc167	C	A	17: 29,705,511	A39S	possibly damaging	Het
Cd274	T	C	19: 29,382,536	L247P	probably benign	Het
Cdhr5	T	C	7: 141,274,448	E138G	probably damaging	Het
Cltb	C	T	13: 54,593,880	C81Y	probably benign	Het
Clvs1	T	C	4: 9,281,865	L103P	possibly damaging	Het
Cntrob	G	T	11: 69,321,891	Q106K	possibly damaging	Het
Ctsh	T	C	9: 90,054,590	L14P	probably damaging	Het
Cubn	T	C	2: 13,287,568	N3268S	probably damaging	Het
Cyb5r4	T	C	9: 87,026,948	V26A	possibly damaging	Het
Ddx18	A	G	1: 121,562,128	I184T	probably damaging	Het
Ddx60	T	A	8: 61,974,188	W766R	probably damaging	Het
Dnah2	C	T	11: 69,458,920	R2399Q	probably benign	Het
Dnah5	G	A	15: 28,272,172	V1041I	probably benign	Het
Dnajc21	A	T	15: 10,463,964	N38K	probably benign	Het
Ermap	T	C	4: 119,185,818		probably null	Het
Fam129a	T	A	1: 151,703,829	L433Q	possibly damaging	Het
Fryl	A	G	5: 73,086,600	L1209P	possibly damaging	Het
Gm5093	T	C	17: 46,439,873	E76G	possibly damaging	Het
Grk6	T	C	13: 55,451,706	C169R	probably damaging	Het
Hmgn1	A	T	16: 96,122,427		probably null	Het
Lpcat2b	T	A	5: 107,434,135	Y443*	probably null	Het
Macf1	T	A	4: 123,472,089	M1395L	probably benign	Het
Mllt10	C	T	2: 18,208,774	Q997*	probably null	Het
Mocos	T	A	18: 24,692,554	V722E	probably damaging	Het
Moxd2	A	T	6: 40,879,337	L534M	probably benign	Het
Mphosph10	T	C	7: 64,385,820	M368V	possibly damaging	Het
Myo15	G	A	11: 60,503,614	G2383D	probably damaging	Het
Myo5b	T	C	18: 74,701,674	I935T	possibly damaging	Het
Ndst4	T	A	3: 125,437,911	L43H	probably damaging	Het
Nsl1	A	G	1: 191,075,190	N189D	probably benign	Het
Olfr558	A	T	7: 102,709,661	H134L	probably damaging	Het
Pcdh8	T	C	14: 79,770,154	D323G	probably damaging	Het
Pkhd1	A	G	1: 20,209,224	S2957P	possibly damaging	Het
Prdm9	T	G	17: 15,562,893	E42D	probably damaging	Het
Rasal1	C	A	5: 120,675,395	H611Q	probably benign	Het
Rif1	T	A	2: 52,081,289	W260R	probably damaging	Het
Rpain	A	G	11: 70,973,832	D115G	probably benign	Het
Rpl3l	T	C	17: 24,732,455	V110A	possibly damaging	Het
Ryr2	T	A	13: 11,772,452	I1012F	probably damaging	Het
Sema4f	A	G	6: 82,917,650	V480A	probably benign	Het
Slc35a3	T	A	3: 116,681,145	K199N	probably damaging	Het
Slc5a6	T	C	5: 31,042,978	Y121C	probably damaging	Het
Slc7a14	T	C	3: 31,237,365		probably null	Het
Sort1	T	A	3: 108,324,676	I172N	probably damaging	Het
Spink5	C	A	18: 43,989,451	H328N	probably damaging	Het
Tbl1xr1	A	G	3: 22,209,606	D504G	probably damaging	Het
Tfap2e	T	C	4: 126,734,641	D174G	probably benign	Het
Tmem42	T	C	9: 123,022,167	V65A	probably damaging	Het
Vmn1r225	C	G	17: 20,502,915	T206R	probably damaging	Het
Vmn2r38	A	G	7: 9,097,572	F65S	probably benign	Het
Vmn2r87	A	T	10: 130,497,339	L14Q	probably null	Het
Xirp2	T	C	2: 67,515,367	S2651P	probably benign	Het
Zfp429	G	A	13: 67,390,840	L162F	probably damaging	Het
Zhx1	A	T	15: 58,052,423	M809K	probably damaging	Het

Other mutations in Tcaf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Tcaf3	APN	6	42593385	missense	probably benign	0.14
IGL00931:Tcaf3	APN	6	42597228	missense	probably benign	0.16
IGL01391:Tcaf3	APN	6	42593681	missense	probably damaging	1.00
IGL01804:Tcaf3	APN	6	42597129	missense	probably damaging	1.00
IGL02272:Tcaf3	APN	6	42596660	missense	probably damaging	0.98
IGL02934:Tcaf3	APN	6	42593898	missense	probably benign	0.00
IGL03258:Tcaf3	APN	6	42589839	missense	probably damaging	1.00
defused	UTSW	6	42596933	missense	probably benign	0.03
R0116:Tcaf3	UTSW	6	42591350	missense	probably benign	0.12
R0135:Tcaf3	UTSW	6	42589758	missense	probably benign
R0357:Tcaf3	UTSW	6	42589827	missense	probably damaging	0.98
R0526:Tcaf3	UTSW	6	42589804	missense	probably damaging	1.00
R0592:Tcaf3	UTSW	6	42596843	missense	probably benign	0.16
R1185:Tcaf3	UTSW	6	42591434	missense	probably damaging	1.00
R1185:Tcaf3	UTSW	6	42591434	missense	probably damaging	1.00
R1185:Tcaf3	UTSW	6	42591434	missense	probably damaging	1.00
R1902:Tcaf3	UTSW	6	42593552	missense	possibly damaging	0.83
R1912:Tcaf3	UTSW	6	42596688	missense	possibly damaging	0.59
R2020:Tcaf3	UTSW	6	42593724	missense	possibly damaging	0.66
R2238:Tcaf3	UTSW	6	42593328	missense	probably benign	0.00
R2259:Tcaf3	UTSW	6	42591430	missense	possibly damaging	0.53
R2436:Tcaf3	UTSW	6	42593729	missense	probably damaging	1.00
R3005:Tcaf3	UTSW	6	42594044	missense	probably damaging	1.00
R3402:Tcaf3	UTSW	6	42593853	missense	probably benign	0.08
R3753:Tcaf3	UTSW	6	42589804	missense	probably damaging	1.00
R3799:Tcaf3	UTSW	6	42597080	missense	probably damaging	1.00
R4515:Tcaf3	UTSW	6	42589996	missense	probably damaging	1.00
R4640:Tcaf3	UTSW	6	42587579	missense	probably damaging	0.96
R4688:Tcaf3	UTSW	6	42593366	splice site	probably null
R4904:Tcaf3	UTSW	6	42593997	nonsense	probably null
R5030:Tcaf3	UTSW	6	42596933	missense	probably benign	0.03
R5031:Tcaf3	UTSW	6	42596933	missense	probably benign	0.03
R5045:Tcaf3	UTSW	6	42593684	missense	possibly damaging	0.55
R5105:Tcaf3	UTSW	6	42591325	missense	probably damaging	1.00
R5139:Tcaf3	UTSW	6	42596933	missense	probably benign	0.03
R5196:Tcaf3	UTSW	6	42593715	missense	probably benign	0.00
R5213:Tcaf3	UTSW	6	42591467	missense	probably damaging	1.00
R5296:Tcaf3	UTSW	6	42587510	missense	possibly damaging	0.55
R5402:Tcaf3	UTSW	6	42591926	missense	probably benign	0.12
R5425:Tcaf3	UTSW	6	42596763	missense	probably damaging	1.00
R5431:Tcaf3	UTSW	6	42597185	missense	probably damaging	1.00
R5601:Tcaf3	UTSW	6	42587528	missense	possibly damaging	0.90
R5839:Tcaf3	UTSW	6	42593849	missense	possibly damaging	0.55
R5865:Tcaf3	UTSW	6	42596697	missense	probably benign	0.07
R6005:Tcaf3	UTSW	6	42589971	missense	probably benign	0.19
R6270:Tcaf3	UTSW	6	42593791	missense	probably benign	0.00
R6341:Tcaf3	UTSW	6	42597259	missense	possibly damaging	0.55
R6344:Tcaf3	UTSW	6	42597171	missense	possibly damaging	0.48
R6521:Tcaf3	UTSW	6	42593238	missense	probably damaging	0.99
R6589:Tcaf3	UTSW	6	42594061	missense	possibly damaging	0.55
R6981:Tcaf3	UTSW	6	42597125	missense	probably damaging	1.00
R7155:Tcaf3	UTSW	6	42593891	missense	probably benign
R7185:Tcaf3	UTSW	6	42593930	missense	probably benign	0.01
R7262:Tcaf3	UTSW	6	42593801	missense	probably damaging	0.97
R7340:Tcaf3	UTSW	6	42589914	missense	probably benign	0.08
R7421:Tcaf3	UTSW	6	42596842	missense	probably benign	0.02
R7690:Tcaf3	UTSW	6	42597135	missense	probably damaging	1.00
R7850:Tcaf3	UTSW	6	42594206	splice site	probably null
R7909:Tcaf3	UTSW	6	42591964	missense	possibly damaging	0.92
R9419:Tcaf3	UTSW	6	42596782	missense	probably benign	0.00
R9440:Tcaf3	UTSW	6	42596972	nonsense	probably null
R9469:Tcaf3	UTSW	6	42596894	missense	probably benign	0.00
R9668:Tcaf3	UTSW	6	42589702	missense	probably damaging	1.00
R9787:Tcaf3	UTSW	6	42597090	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGTGAGCAGCCCAATTCAAAG -3'
(R):5'- CAGTGAACTTCTCCTTACTGGGG -3'

Sequencing Primer
(F):5'- CTCCATTCTTCAGGAATTGGATCAG -3'
(R):5'- CTTACTGGGGAGTCAGCCTTC -3'

Posted On

2016-07-06