Incidental Mutation 'R5187:Sema4f'
ID397962
Institutional Source Beutler Lab
Gene Symbol Sema4f
Ensembl Gene ENSMUSG00000000627
Gene Namesema domain, immunoglobulin domain (Ig), TM domain, and short cytoplasmic domain
SynonymsSema W
MMRRC Submission 042766-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5187 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location82911885-82939769 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82917650 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 480 (V480A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000641] [ENSMUST00000203271]
Predicted Effect probably benign
Transcript: ENSMUST00000000641
AA Change: V480A

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000000641
Gene: ENSMUSG00000000627
AA Change: V480A

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Sema 71 502 2.23e-170 SMART
PSI 518 569 2.64e-12 SMART
Blast:Sema 607 656 5e-20 BLAST
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 722 735 N/A INTRINSIC
low complexity region 743 751 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113982
AA Change: V480A

PolyPhen 2 Score 0.452 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109615
Gene: ENSMUSG00000000627
AA Change: V480A

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Sema 71 502 2.23e-170 SMART
PSI 518 554 4.01e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125579
Predicted Effect probably benign
Transcript: ENSMUST00000203271
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203911
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of semaphorin family of membrane-bound and secreted proteins that are involved in guiding axonal growth. The encoded protein is a transmembrane protein localized to the glutamatergic synapses via its association with a synapse-associated scaffolding protein. In oligodendrocyte precursor cells, the encoded protein contributes to the outward migration and differentiation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2015]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,718,809 L620* probably null Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abcg5 A G 17: 84,658,564 L628S probably damaging Het
Acbd3 C T 1: 180,736,732 R201* probably null Het
Adsl A G 15: 80,948,905 probably benign Het
Asic1 GCACC GCACCACC 15: 99,698,803 probably benign Het
Cachd1 T C 4: 100,966,200 V483A possibly damaging Het
Calm1 T C 12: 100,200,213 S19P probably benign Het
Casq1 T C 1: 172,213,074 N313S possibly damaging Het
Cav2 G T 6: 17,286,936 A64S possibly damaging Het
Ccdc114 A G 7: 45,929,116 I77V probably damaging Het
Ccdc167 C A 17: 29,705,511 A39S possibly damaging Het
Cd274 T C 19: 29,382,536 L247P probably benign Het
Cdhr5 T C 7: 141,274,448 E138G probably damaging Het
Cltb C T 13: 54,593,880 C81Y probably benign Het
Clvs1 T C 4: 9,281,865 L103P possibly damaging Het
Cntrob G T 11: 69,321,891 Q106K possibly damaging Het
Ctsh T C 9: 90,054,590 L14P probably damaging Het
Cubn T C 2: 13,287,568 N3268S probably damaging Het
Cyb5r4 T C 9: 87,026,948 V26A possibly damaging Het
Ddx18 A G 1: 121,562,128 I184T probably damaging Het
Ddx60 T A 8: 61,974,188 W766R probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnah5 G A 15: 28,272,172 V1041I probably benign Het
Dnajc21 A T 15: 10,463,964 N38K probably benign Het
Ermap T C 4: 119,185,818 probably null Het
Fam129a T A 1: 151,703,829 L433Q possibly damaging Het
Fryl A G 5: 73,086,600 L1209P possibly damaging Het
Gm5093 T C 17: 46,439,873 E76G possibly damaging Het
Grk6 T C 13: 55,451,706 C169R probably damaging Het
Hmgn1 A T 16: 96,122,427 probably null Het
Lpcat2b T A 5: 107,434,135 Y443* probably null Het
Macf1 T A 4: 123,472,089 M1395L probably benign Het
Mllt10 C T 2: 18,208,774 Q997* probably null Het
Mocos T A 18: 24,692,554 V722E probably damaging Het
Moxd2 A T 6: 40,879,337 L534M probably benign Het
Mphosph10 T C 7: 64,385,820 M368V possibly damaging Het
Myo15 G A 11: 60,503,614 G2383D probably damaging Het
Myo5b T C 18: 74,701,674 I935T possibly damaging Het
Ndst4 T A 3: 125,437,911 L43H probably damaging Het
Nsl1 A G 1: 191,075,190 N189D probably benign Het
Olfr558 A T 7: 102,709,661 H134L probably damaging Het
Pcdh8 T C 14: 79,770,154 D323G probably damaging Het
Pkhd1 A G 1: 20,209,224 S2957P possibly damaging Het
Prdm9 T G 17: 15,562,893 E42D probably damaging Het
Rasal1 C A 5: 120,675,395 H611Q probably benign Het
Rif1 T A 2: 52,081,289 W260R probably damaging Het
Rpain A G 11: 70,973,832 D115G probably benign Het
Rpl3l T C 17: 24,732,455 V110A possibly damaging Het
Ryr2 T A 13: 11,772,452 I1012F probably damaging Het
Slc35a3 T A 3: 116,681,145 K199N probably damaging Het
Slc5a6 T C 5: 31,042,978 Y121C probably damaging Het
Slc7a14 T C 3: 31,237,365 probably null Het
Sort1 T A 3: 108,324,676 I172N probably damaging Het
Spink5 C A 18: 43,989,451 H328N probably damaging Het
Tbl1xr1 A G 3: 22,209,606 D504G probably damaging Het
Tcaf3 C T 6: 42,597,020 C86Y possibly damaging Het
Tfap2e T C 4: 126,734,641 D174G probably benign Het
Tmem42 T C 9: 123,022,167 V65A probably damaging Het
Vmn1r225 C G 17: 20,502,915 T206R probably damaging Het
Vmn2r38 A G 7: 9,097,572 F65S probably benign Het
Vmn2r87 A T 10: 130,497,339 L14Q probably null Het
Xirp2 T C 2: 67,515,367 S2651P probably benign Het
Zfp429 G A 13: 67,390,840 L162F probably damaging Het
Zhx1 A T 15: 58,052,423 M809K probably damaging Het
Other mutations in Sema4f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Sema4f APN 6 82937174 missense probably benign 0.00
IGL01661:Sema4f APN 6 82918055 unclassified probably benign
R0054:Sema4f UTSW 6 82919693 splice site probably benign
R0054:Sema4f UTSW 6 82919693 splice site probably benign
R0243:Sema4f UTSW 6 82939466 missense possibly damaging 0.87
R0692:Sema4f UTSW 6 82939530 unclassified probably benign
R0893:Sema4f UTSW 6 82935967 splice site probably benign
R1708:Sema4f UTSW 6 82917994 missense probably damaging 1.00
R1833:Sema4f UTSW 6 82918559 missense probably benign 0.02
R1867:Sema4f UTSW 6 82917843 missense possibly damaging 0.84
R1899:Sema4f UTSW 6 82918029 missense probably benign 0.00
R1933:Sema4f UTSW 6 82930927 missense probably damaging 1.00
R1934:Sema4f UTSW 6 82930927 missense probably damaging 1.00
R2433:Sema4f UTSW 6 82939509 missense possibly damaging 0.66
R3801:Sema4f UTSW 6 82918627 missense possibly damaging 0.88
R4116:Sema4f UTSW 6 82917906 missense probably benign 0.25
R4745:Sema4f UTSW 6 82918284 missense probably damaging 1.00
R6015:Sema4f UTSW 6 82939572 unclassified probably benign
R6043:Sema4f UTSW 6 82919653 missense probably damaging 0.99
R6110:Sema4f UTSW 6 82937104 missense probably damaging 0.97
R6378:Sema4f UTSW 6 82917632 nonsense probably null
R6449:Sema4f UTSW 6 82917870 missense probably benign 0.09
R6452:Sema4f UTSW 6 82917662 missense probably benign 0.36
R6854:Sema4f UTSW 6 82918002 missense probably damaging 1.00
R7159:Sema4f UTSW 6 82917883 missense possibly damaging 0.63
R7475:Sema4f UTSW 6 82914374 missense possibly damaging 0.94
R7555:Sema4f UTSW 6 82914056 missense probably benign 0.01
R7780:Sema4f UTSW 6 82913960 missense possibly damaging 0.95
X0026:Sema4f UTSW 6 82935680 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CTTGTGTCACCTCAGTATGGGAG -3'
(R):5'- ATGATGTGCTCTACCTGGGG -3'

Sequencing Primer
(F):5'- ACCAGAAGCCAATCCTGTAGAAATGG -3'
(R):5'- TGGGGACAGGTATACAGCATC -3'
Posted On2016-07-06