Incidental Mutation 'R5187:Vmn2r87'
ID397968
Institutional Source Beutler Lab
Gene Symbol Vmn2r87
Ensembl Gene ENSMUSG00000091511
Gene Namevomeronasal 2, receptor 87
SynonymsEG625131
MMRRC Submission 042766-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R5187 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location130471332-130497379 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 130497339 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 14 (L14Q)
Ref Sequence ENSEMBL: ENSMUSP00000129215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164227]
Predicted Effect probably null
Transcript: ENSMUST00000164227
AA Change: L14Q

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129215
Gene: ENSMUSG00000091511
AA Change: L14Q

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 77 422 1.8e-27 PFAM
Pfam:NCD3G 508 562 1.8e-19 PFAM
Pfam:7tm_3 595 829 8.8e-55 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,718,809 L620* probably null Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abcg5 A G 17: 84,658,564 L628S probably damaging Het
Acbd3 C T 1: 180,736,732 R201* probably null Het
Adsl A G 15: 80,948,905 probably benign Het
Asic1 GCACC GCACCACC 15: 99,698,803 probably benign Het
Cachd1 T C 4: 100,966,200 V483A possibly damaging Het
Calm1 T C 12: 100,200,213 S19P probably benign Het
Casq1 T C 1: 172,213,074 N313S possibly damaging Het
Cav2 G T 6: 17,286,936 A64S possibly damaging Het
Ccdc114 A G 7: 45,929,116 I77V probably damaging Het
Ccdc167 C A 17: 29,705,511 A39S possibly damaging Het
Cd274 T C 19: 29,382,536 L247P probably benign Het
Cdhr5 T C 7: 141,274,448 E138G probably damaging Het
Cltb C T 13: 54,593,880 C81Y probably benign Het
Clvs1 T C 4: 9,281,865 L103P possibly damaging Het
Cntrob G T 11: 69,321,891 Q106K possibly damaging Het
Ctsh T C 9: 90,054,590 L14P probably damaging Het
Cubn T C 2: 13,287,568 N3268S probably damaging Het
Cyb5r4 T C 9: 87,026,948 V26A possibly damaging Het
Ddx18 A G 1: 121,562,128 I184T probably damaging Het
Ddx60 T A 8: 61,974,188 W766R probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnah5 G A 15: 28,272,172 V1041I probably benign Het
Dnajc21 A T 15: 10,463,964 N38K probably benign Het
Ermap T C 4: 119,185,818 probably null Het
Fam129a T A 1: 151,703,829 L433Q possibly damaging Het
Fryl A G 5: 73,086,600 L1209P possibly damaging Het
Gm5093 T C 17: 46,439,873 E76G possibly damaging Het
Grk6 T C 13: 55,451,706 C169R probably damaging Het
Hmgn1 A T 16: 96,122,427 probably null Het
Lpcat2b T A 5: 107,434,135 Y443* probably null Het
Macf1 T A 4: 123,472,089 M1395L probably benign Het
Mllt10 C T 2: 18,208,774 Q997* probably null Het
Mocos T A 18: 24,692,554 V722E probably damaging Het
Moxd2 A T 6: 40,879,337 L534M probably benign Het
Mphosph10 T C 7: 64,385,820 M368V possibly damaging Het
Myo15 G A 11: 60,503,614 G2383D probably damaging Het
Myo5b T C 18: 74,701,674 I935T possibly damaging Het
Ndst4 T A 3: 125,437,911 L43H probably damaging Het
Nsl1 A G 1: 191,075,190 N189D probably benign Het
Olfr558 A T 7: 102,709,661 H134L probably damaging Het
Pcdh8 T C 14: 79,770,154 D323G probably damaging Het
Pkhd1 A G 1: 20,209,224 S2957P possibly damaging Het
Prdm9 T G 17: 15,562,893 E42D probably damaging Het
Rasal1 C A 5: 120,675,395 H611Q probably benign Het
Rif1 T A 2: 52,081,289 W260R probably damaging Het
Rpain A G 11: 70,973,832 D115G probably benign Het
Rpl3l T C 17: 24,732,455 V110A possibly damaging Het
Ryr2 T A 13: 11,772,452 I1012F probably damaging Het
Sema4f A G 6: 82,917,650 V480A probably benign Het
Slc35a3 T A 3: 116,681,145 K199N probably damaging Het
Slc5a6 T C 5: 31,042,978 Y121C probably damaging Het
Slc7a14 T C 3: 31,237,365 probably null Het
Sort1 T A 3: 108,324,676 I172N probably damaging Het
Spink5 C A 18: 43,989,451 H328N probably damaging Het
Tbl1xr1 A G 3: 22,209,606 D504G probably damaging Het
Tcaf3 C T 6: 42,597,020 C86Y possibly damaging Het
Tfap2e T C 4: 126,734,641 D174G probably benign Het
Tmem42 T C 9: 123,022,167 V65A probably damaging Het
Vmn1r225 C G 17: 20,502,915 T206R probably damaging Het
Vmn2r38 A G 7: 9,097,572 F65S probably benign Het
Xirp2 T C 2: 67,515,367 S2651P probably benign Het
Zfp429 G A 13: 67,390,840 L162F probably damaging Het
Zhx1 A T 15: 58,052,423 M809K probably damaging Het
Other mutations in Vmn2r87
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Vmn2r87 APN 10 130497378 start codon destroyed probably null 1.00
IGL01295:Vmn2r87 APN 10 130472009 missense probably damaging 1.00
IGL01411:Vmn2r87 APN 10 130472560 missense probably benign 0.03
IGL01680:Vmn2r87 APN 10 130479717 nonsense probably null
IGL01822:Vmn2r87 APN 10 130472122 missense probably damaging 1.00
IGL01835:Vmn2r87 APN 10 130479109 missense probably damaging 1.00
IGL01965:Vmn2r87 APN 10 130479055 missense possibly damaging 0.49
IGL02562:Vmn2r87 APN 10 130478644 missense probably damaging 1.00
IGL02665:Vmn2r87 APN 10 130497180 missense probably benign 0.16
IGL03202:Vmn2r87 APN 10 130497222 missense probably benign
FR4304:Vmn2r87 UTSW 10 130478714 missense probably benign 0.01
FR4340:Vmn2r87 UTSW 10 130478714 missense probably benign 0.01
FR4342:Vmn2r87 UTSW 10 130478714 missense probably benign 0.01
FR4589:Vmn2r87 UTSW 10 130478714 missense probably benign 0.01
LCD18:Vmn2r87 UTSW 10 130478714 missense probably benign 0.01
R0344:Vmn2r87 UTSW 10 130479937 missense probably damaging 1.00
R0374:Vmn2r87 UTSW 10 130471979 missense probably damaging 1.00
R0384:Vmn2r87 UTSW 10 130471843 missense probably benign
R1144:Vmn2r87 UTSW 10 130476229 splice site probably benign
R1172:Vmn2r87 UTSW 10 130477584 missense probably benign 0.03
R1860:Vmn2r87 UTSW 10 130479886 missense probably benign 0.00
R1866:Vmn2r87 UTSW 10 130472572 missense possibly damaging 0.88
R1897:Vmn2r87 UTSW 10 130471960 missense probably damaging 1.00
R2360:Vmn2r87 UTSW 10 130479762 missense probably damaging 0.99
R2909:Vmn2r87 UTSW 10 130478996 missense probably damaging 0.99
R3874:Vmn2r87 UTSW 10 130479987 missense possibly damaging 0.62
R4113:Vmn2r87 UTSW 10 130479822 missense probably benign
R4190:Vmn2r87 UTSW 10 130472687 missense probably damaging 1.00
R4197:Vmn2r87 UTSW 10 130479910 missense possibly damaging 0.55
R4201:Vmn2r87 UTSW 10 130472579 missense probably benign 0.03
R4202:Vmn2r87 UTSW 10 130472579 missense probably benign 0.03
R4368:Vmn2r87 UTSW 10 130479807 missense probably benign 0.44
R4485:Vmn2r87 UTSW 10 130479809 nonsense probably null
R4537:Vmn2r87 UTSW 10 130472185 missense probably benign 0.12
R4590:Vmn2r87 UTSW 10 130479145 missense possibly damaging 0.69
R4752:Vmn2r87 UTSW 10 130478467 nonsense probably null
R4873:Vmn2r87 UTSW 10 130472498 missense probably damaging 1.00
R4875:Vmn2r87 UTSW 10 130472498 missense probably damaging 1.00
R4923:Vmn2r87 UTSW 10 130478566 missense probably damaging 0.99
R4970:Vmn2r87 UTSW 10 130478553 missense probably damaging 1.00
R5049:Vmn2r87 UTSW 10 130472429 missense probably damaging 0.96
R5112:Vmn2r87 UTSW 10 130478553 missense probably damaging 1.00
R5618:Vmn2r87 UTSW 10 130479948 missense probably damaging 1.00
R6057:Vmn2r87 UTSW 10 130472357 missense probably benign 0.02
R6220:Vmn2r87 UTSW 10 130479938 missense probably benign 0.01
R6287:Vmn2r87 UTSW 10 130478422 critical splice donor site probably null
R6383:Vmn2r87 UTSW 10 130479000 missense probably damaging 1.00
R6576:Vmn2r87 UTSW 10 130478785 missense probably benign 0.05
R6742:Vmn2r87 UTSW 10 130472527 missense probably damaging 1.00
R7086:Vmn2r87 UTSW 10 130497309 missense probably benign 0.00
R7162:Vmn2r87 UTSW 10 130477547 missense probably benign 0.08
R7419:Vmn2r87 UTSW 10 130472123 missense probably damaging 1.00
R7425:Vmn2r87 UTSW 10 130478892 missense probably damaging 1.00
R7443:Vmn2r87 UTSW 10 130472719 missense probably damaging 1.00
R7571:Vmn2r87 UTSW 10 130479071 missense probably damaging 0.99
R7663:Vmn2r87 UTSW 10 130472185 missense probably damaging 0.97
R7716:Vmn2r87 UTSW 10 130472149 missense probably benign 0.09
R7793:Vmn2r87 UTSW 10 130477544 missense probably benign 0.05
R7806:Vmn2r87 UTSW 10 130479810 missense probably benign
R7841:Vmn2r87 UTSW 10 130497226 missense probably benign 0.31
R7924:Vmn2r87 UTSW 10 130497226 missense probably benign 0.31
Z1088:Vmn2r87 UTSW 10 130472314 missense probably damaging 0.98
Z1176:Vmn2r87 UTSW 10 130471844 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGAATCCACAGTTTGTGTACACAG -3'
(R):5'- GTCCAGGGAGCATGACATAG -3'

Sequencing Primer
(F):5'- CTCCATTGTCCAAAGGAAGA -3'
(R):5'- TAGGATGAATGGAAAGGAACTGTTG -3'
Posted On2016-07-06