Incidental Mutation 'R5187:Dnajc21'
ID397982
Institutional Source Beutler Lab
Gene Symbol Dnajc21
Ensembl Gene ENSMUSG00000044224
Gene NameDnaJ heat shock protein family (Hsp40) member C21
Synonyms9930116P15Rik, 4930461P20Rik
MMRRC Submission 042766-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R5187 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location10446756-10470516 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 10463964 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 38 (N38K)
Ref Sequence ENSEMBL: ENSMUSP00000116865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000136591]
Predicted Effect probably benign
Transcript: ENSMUST00000136591
AA Change: N38K

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000116865
Gene: ENSMUSG00000044224
AA Change: N38K

DomainStartEndE-ValueType
DnaJ 2 61 7.2e-29 SMART
coiled coil region 178 283 N/A INTRINSIC
ZnF_U1 311 345 5.3e-8 SMART
ZnF_C2H2 314 338 1.67e-2 SMART
low complexity region 379 393 N/A INTRINSIC
low complexity region 452 470 N/A INTRINSIC
ZnF_C2H2 483 507 5.34e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145719
SMART Domains Protein: ENSMUSP00000116192
Gene: ENSMUSG00000044224

DomainStartEndE-ValueType
coiled coil region 26 131 N/A INTRINSIC
ZnF_U1 160 194 5.3e-8 SMART
ZnF_C2H2 163 187 1.67e-2 SMART
low complexity region 228 242 N/A INTRINSIC
low complexity region 301 319 N/A INTRINSIC
ZnF_C2H2 332 356 5.34e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147224
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNAJ heat shock protein 40 family of proteins that is characterized by two N-terminal tetratricopeptide repeat domains and a C-terminal DNAJ domain. This protein binds the precursor 45S ribosomal RNA and may be involved in early nuclear ribosomal RNA biogenesis and maturation of the 60S ribosomal subunit. Mutations in this gene result in Bone marrow failure syndrome 3. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,718,809 L620* probably null Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abcg5 A G 17: 84,658,564 L628S probably damaging Het
Acbd3 C T 1: 180,736,732 R201* probably null Het
Adsl A G 15: 80,948,905 probably benign Het
Asic1 GCACC GCACCACC 15: 99,698,803 probably benign Het
Cachd1 T C 4: 100,966,200 V483A possibly damaging Het
Calm1 T C 12: 100,200,213 S19P probably benign Het
Casq1 T C 1: 172,213,074 N313S possibly damaging Het
Cav2 G T 6: 17,286,936 A64S possibly damaging Het
Ccdc114 A G 7: 45,929,116 I77V probably damaging Het
Ccdc167 C A 17: 29,705,511 A39S possibly damaging Het
Cd274 T C 19: 29,382,536 L247P probably benign Het
Cdhr5 T C 7: 141,274,448 E138G probably damaging Het
Cltb C T 13: 54,593,880 C81Y probably benign Het
Clvs1 T C 4: 9,281,865 L103P possibly damaging Het
Cntrob G T 11: 69,321,891 Q106K possibly damaging Het
Ctsh T C 9: 90,054,590 L14P probably damaging Het
Cubn T C 2: 13,287,568 N3268S probably damaging Het
Cyb5r4 T C 9: 87,026,948 V26A possibly damaging Het
Ddx18 A G 1: 121,562,128 I184T probably damaging Het
Ddx60 T A 8: 61,974,188 W766R probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnah5 G A 15: 28,272,172 V1041I probably benign Het
Ermap T C 4: 119,185,818 probably null Het
Fam129a T A 1: 151,703,829 L433Q possibly damaging Het
Fryl A G 5: 73,086,600 L1209P possibly damaging Het
Gm5093 T C 17: 46,439,873 E76G possibly damaging Het
Grk6 T C 13: 55,451,706 C169R probably damaging Het
Hmgn1 A T 16: 96,122,427 probably null Het
Lpcat2b T A 5: 107,434,135 Y443* probably null Het
Macf1 T A 4: 123,472,089 M1395L probably benign Het
Mllt10 C T 2: 18,208,774 Q997* probably null Het
Mocos T A 18: 24,692,554 V722E probably damaging Het
Moxd2 A T 6: 40,879,337 L534M probably benign Het
Mphosph10 T C 7: 64,385,820 M368V possibly damaging Het
Myo15 G A 11: 60,503,614 G2383D probably damaging Het
Myo5b T C 18: 74,701,674 I935T possibly damaging Het
Ndst4 T A 3: 125,437,911 L43H probably damaging Het
Nsl1 A G 1: 191,075,190 N189D probably benign Het
Olfr558 A T 7: 102,709,661 H134L probably damaging Het
Pcdh8 T C 14: 79,770,154 D323G probably damaging Het
Pkhd1 A G 1: 20,209,224 S2957P possibly damaging Het
Prdm9 T G 17: 15,562,893 E42D probably damaging Het
Rasal1 C A 5: 120,675,395 H611Q probably benign Het
Rif1 T A 2: 52,081,289 W260R probably damaging Het
Rpain A G 11: 70,973,832 D115G probably benign Het
Rpl3l T C 17: 24,732,455 V110A possibly damaging Het
Ryr2 T A 13: 11,772,452 I1012F probably damaging Het
Sema4f A G 6: 82,917,650 V480A probably benign Het
Slc35a3 T A 3: 116,681,145 K199N probably damaging Het
Slc5a6 T C 5: 31,042,978 Y121C probably damaging Het
Slc7a14 T C 3: 31,237,365 probably null Het
Sort1 T A 3: 108,324,676 I172N probably damaging Het
Spink5 C A 18: 43,989,451 H328N probably damaging Het
Tbl1xr1 A G 3: 22,209,606 D504G probably damaging Het
Tcaf3 C T 6: 42,597,020 C86Y possibly damaging Het
Tfap2e T C 4: 126,734,641 D174G probably benign Het
Tmem42 T C 9: 123,022,167 V65A probably damaging Het
Vmn1r225 C G 17: 20,502,915 T206R probably damaging Het
Vmn2r38 A G 7: 9,097,572 F65S probably benign Het
Vmn2r87 A T 10: 130,497,339 L14Q probably null Het
Xirp2 T C 2: 67,515,367 S2651P probably benign Het
Zfp429 G A 13: 67,390,840 L162F probably damaging Het
Zhx1 A T 15: 58,052,423 M809K probably damaging Het
Other mutations in Dnajc21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01321:Dnajc21 APN 15 10447102 missense probably benign 0.01
IGL02797:Dnajc21 APN 15 10461355 missense probably damaging 0.96
R0032:Dnajc21 UTSW 15 10461877 missense probably benign 0.32
R0032:Dnajc21 UTSW 15 10461877 missense probably benign 0.32
R1480:Dnajc21 UTSW 15 10459951 splice site probably null
R1694:Dnajc21 UTSW 15 10451563 missense probably benign 0.00
R1777:Dnajc21 UTSW 15 10449607 missense probably benign 0.00
R2420:Dnajc21 UTSW 15 10461935 missense probably benign 0.00
R2421:Dnajc21 UTSW 15 10461935 missense probably benign 0.00
R2422:Dnajc21 UTSW 15 10461935 missense probably benign 0.00
R4065:Dnajc21 UTSW 15 10451553 critical splice donor site probably null
R4182:Dnajc21 UTSW 15 10459933 splice site probably null
R4546:Dnajc21 UTSW 15 10447097 missense probably benign 0.01
R4644:Dnajc21 UTSW 15 10463917 missense possibly damaging 0.89
R4939:Dnajc21 UTSW 15 10449597 missense probably damaging 0.96
R5075:Dnajc21 UTSW 15 10461877 missense probably benign 0.32
R5273:Dnajc21 UTSW 15 10454807 missense probably damaging 1.00
R5590:Dnajc21 UTSW 15 10462277 missense possibly damaging 0.92
R5643:Dnajc21 UTSW 15 10461915 missense probably benign
R5644:Dnajc21 UTSW 15 10461915 missense probably benign
R5729:Dnajc21 UTSW 15 10449596 missense probably benign 0.01
R6614:Dnajc21 UTSW 15 10470263 critical splice donor site probably null
R6815:Dnajc21 UTSW 15 10447691 splice site probably null
R7016:Dnajc21 UTSW 15 10461407 nonsense probably null
R7076:Dnajc21 UTSW 15 10449631 missense probably benign
R7584:Dnajc21 UTSW 15 10462295 nonsense probably null
R7624:Dnajc21 UTSW 15 10461232 missense probably benign 0.07
R7624:Dnajc21 UTSW 15 10461234 missense probably damaging 0.98
R7676:Dnajc21 UTSW 15 10462344 missense possibly damaging 0.95
R7788:Dnajc21 UTSW 15 10460047 missense probably damaging 1.00
R7845:Dnajc21 UTSW 15 10447141 missense probably damaging 1.00
R8552:Dnajc21 UTSW 15 10463919 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTCCCAACCACTCAGTGTG -3'
(R):5'- TTTGCAGTTAAGGAAGCATGACC -3'

Sequencing Primer
(F):5'- CACTCAGTGTGGTAAACTGTTAAG -3'
(R):5'- TCAGTGATTGAACTCAGGCC -3'
Posted On2016-07-06