Incidental Mutation 'R5187:Prdm9'
ID397988
Institutional Source Beutler Lab
Gene Symbol Prdm9
Ensembl Gene ENSMUSG00000051977
Gene NamePR domain containing 9
SynonymsDsbc1, repro7, Rcr1, Meisetz, G1-419-29
MMRRC Submission 042766-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.350) question?
Stock #R5187 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location15543079-15564354 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 15562893 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 42 (E42D)
Ref Sequence ENSEMBL: ENSMUSP00000131871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000147532] [ENSMUST00000167994]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132675
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139911
Predicted Effect probably benign
Transcript: ENSMUST00000147532
SMART Domains Protein: ENSMUSP00000118454
Gene: ENSMUSG00000051977

DomainStartEndE-ValueType
Pfam:SSXRD 49 81 1.8e-19 PFAM
SET 123 243 2.56e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167994
AA Change: E42D

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131871
Gene: ENSMUSG00000051977
AA Change: E42D

DomainStartEndE-ValueType
KRAB 30 89 5.54e-8 SMART
Pfam:SSXRD 175 205 1.5e-20 PFAM
SET 248 368 2.56e-2 SMART
ZnF_C2H2 392 415 3.29e-1 SMART
ZnF_C2H2 516 535 4.74e1 SMART
ZnF_C2H2 541 563 9.73e-4 SMART
ZnF_C2H2 569 591 1.3e-4 SMART
ZnF_C2H2 597 619 1.3e-4 SMART
ZnF_C2H2 625 647 4.24e-4 SMART
ZnF_C2H2 653 675 4.24e-4 SMART
ZnF_C2H2 681 703 1.95e-3 SMART
ZnF_C2H2 709 731 5.99e-4 SMART
ZnF_C2H2 737 759 1.95e-3 SMART
ZnF_C2H2 765 787 1.95e-3 SMART
ZnF_C2H2 793 815 1.3e-4 SMART
ZnF_C2H2 821 843 1.6e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178455
SMART Domains Protein: ENSMUSP00000137164
Gene: ENSMUSG00000095920

DomainStartEndE-ValueType
Pfam:Ribosomal_S21 11 50 1.4e-13 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger protein with histone methyltransferase activity that catalyzes histone H3 lysine 4 trimethylation (H3K4me3) during meiotic prophase. This protein contains multiple domains, including a Kruppel-associated box (KRAB) domain, an SSX repression domain (SSXRD), a PRD1-BF1 and RIZ homologous region, a subclass of SET (PR/SET) domain, and a tandem array of C2H2 zinc fingers. The zinc finger array recognizes a short sequence motif, leading to local H3K4me3, and meiotic recombination hotspot activity. The observed allelic variation alters the DNA-binding sequence specificity of the protein, resulting in distinct meiotic recombination hotspots amongst individuals and populations. Multiple alternate alleles of this gene have been described. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a knock-out allele show decreased oocyte number, azoospermia, and sterility in both sexes due to severe impairment of the double-stranded break repair pathway, deficient pairing of homologous chromosomes, and impaired sex body formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,718,809 L620* probably null Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abcg5 A G 17: 84,658,564 L628S probably damaging Het
Acbd3 C T 1: 180,736,732 R201* probably null Het
Adsl A G 15: 80,948,905 probably benign Het
Asic1 GCACC GCACCACC 15: 99,698,803 probably benign Het
Cachd1 T C 4: 100,966,200 V483A possibly damaging Het
Calm1 T C 12: 100,200,213 S19P probably benign Het
Casq1 T C 1: 172,213,074 N313S possibly damaging Het
Cav2 G T 6: 17,286,936 A64S possibly damaging Het
Ccdc114 A G 7: 45,929,116 I77V probably damaging Het
Ccdc167 C A 17: 29,705,511 A39S possibly damaging Het
Cd274 T C 19: 29,382,536 L247P probably benign Het
Cdhr5 T C 7: 141,274,448 E138G probably damaging Het
Cltb C T 13: 54,593,880 C81Y probably benign Het
Clvs1 T C 4: 9,281,865 L103P possibly damaging Het
Cntrob G T 11: 69,321,891 Q106K possibly damaging Het
Ctsh T C 9: 90,054,590 L14P probably damaging Het
Cubn T C 2: 13,287,568 N3268S probably damaging Het
Cyb5r4 T C 9: 87,026,948 V26A possibly damaging Het
Ddx18 A G 1: 121,562,128 I184T probably damaging Het
Ddx60 T A 8: 61,974,188 W766R probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnah5 G A 15: 28,272,172 V1041I probably benign Het
Dnajc21 A T 15: 10,463,964 N38K probably benign Het
Ermap T C 4: 119,185,818 probably null Het
Fam129a T A 1: 151,703,829 L433Q possibly damaging Het
Fryl A G 5: 73,086,600 L1209P possibly damaging Het
Gm5093 T C 17: 46,439,873 E76G possibly damaging Het
Grk6 T C 13: 55,451,706 C169R probably damaging Het
Hmgn1 A T 16: 96,122,427 probably null Het
Lpcat2b T A 5: 107,434,135 Y443* probably null Het
Macf1 T A 4: 123,472,089 M1395L probably benign Het
Mllt10 C T 2: 18,208,774 Q997* probably null Het
Mocos T A 18: 24,692,554 V722E probably damaging Het
Moxd2 A T 6: 40,879,337 L534M probably benign Het
Mphosph10 T C 7: 64,385,820 M368V possibly damaging Het
Myo15 G A 11: 60,503,614 G2383D probably damaging Het
Myo5b T C 18: 74,701,674 I935T possibly damaging Het
Ndst4 T A 3: 125,437,911 L43H probably damaging Het
Nsl1 A G 1: 191,075,190 N189D probably benign Het
Olfr558 A T 7: 102,709,661 H134L probably damaging Het
Pcdh8 T C 14: 79,770,154 D323G probably damaging Het
Pkhd1 A G 1: 20,209,224 S2957P possibly damaging Het
Rasal1 C A 5: 120,675,395 H611Q probably benign Het
Rif1 T A 2: 52,081,289 W260R probably damaging Het
Rpain A G 11: 70,973,832 D115G probably benign Het
Rpl3l T C 17: 24,732,455 V110A possibly damaging Het
Ryr2 T A 13: 11,772,452 I1012F probably damaging Het
Sema4f A G 6: 82,917,650 V480A probably benign Het
Slc35a3 T A 3: 116,681,145 K199N probably damaging Het
Slc5a6 T C 5: 31,042,978 Y121C probably damaging Het
Slc7a14 T C 3: 31,237,365 probably null Het
Sort1 T A 3: 108,324,676 I172N probably damaging Het
Spink5 C A 18: 43,989,451 H328N probably damaging Het
Tbl1xr1 A G 3: 22,209,606 D504G probably damaging Het
Tcaf3 C T 6: 42,597,020 C86Y possibly damaging Het
Tfap2e T C 4: 126,734,641 D174G probably benign Het
Tmem42 T C 9: 123,022,167 V65A probably damaging Het
Vmn1r225 C G 17: 20,502,915 T206R probably damaging Het
Vmn2r38 A G 7: 9,097,572 F65S probably benign Het
Vmn2r87 A T 10: 130,497,339 L14Q probably null Het
Xirp2 T C 2: 67,515,367 S2651P probably benign Het
Zfp429 G A 13: 67,390,840 L162F probably damaging Het
Zhx1 A T 15: 58,052,423 M809K probably damaging Het
Other mutations in Prdm9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Prdm9 APN 17 15553346 missense probably benign 0.11
IGL02322:Prdm9 APN 17 15562848 missense probably damaging 0.99
IGL02354:Prdm9 APN 17 15562847 missense probably damaging 1.00
IGL02361:Prdm9 APN 17 15562847 missense probably damaging 1.00
IGL02724:Prdm9 APN 17 15563260 missense probably benign 0.07
IGL03120:Prdm9 APN 17 15544931 missense probably benign
berlin UTSW 17 15562440 missense probably damaging 0.96
R0173:Prdm9 UTSW 17 15544013 missense probably benign 0.02
R0173:Prdm9 UTSW 17 15544035 missense probably benign 0.00
R0309:Prdm9 UTSW 17 15557384 missense probably damaging 0.98
R1420:Prdm9 UTSW 17 15544376 missense probably damaging 1.00
R3498:Prdm9 UTSW 17 15562945 splice site probably benign
R3714:Prdm9 UTSW 17 15557361 nonsense probably null
R4118:Prdm9 UTSW 17 15544013 missense probably benign 0.02
R4369:Prdm9 UTSW 17 15544446 missense probably benign 0.14
R4691:Prdm9 UTSW 17 15553378 missense probably benign 0.03
R4742:Prdm9 UTSW 17 15553521 missense probably damaging 0.99
R4910:Prdm9 UTSW 17 15544323 missense probably benign 0.08
R5056:Prdm9 UTSW 17 15562417 missense possibly damaging 0.93
R5130:Prdm9 UTSW 17 15544467 missense probably benign 0.00
R5175:Prdm9 UTSW 17 15557451 missense probably benign 0.04
R5213:Prdm9 UTSW 17 15555154 missense probably damaging 0.98
R5270:Prdm9 UTSW 17 15553363 missense probably benign 0.16
R5635:Prdm9 UTSW 17 15562440 missense probably damaging 0.96
R6753:Prdm9 UTSW 17 15544956 missense probably benign 0.00
R6857:Prdm9 UTSW 17 15544256 missense probably benign 0.04
R7041:Prdm9 UTSW 17 15544995 missense possibly damaging 0.56
R7355:Prdm9 UTSW 17 15545235 missense probably benign 0.01
R7410:Prdm9 UTSW 17 15544997 missense possibly damaging 0.73
R7570:Prdm9 UTSW 17 15555652 missense probably benign 0.14
R7571:Prdm9 UTSW 17 15563264 missense probably damaging 0.98
R7575:Prdm9 UTSW 17 15544628 missense probably damaging 1.00
R7593:Prdm9 UTSW 17 15544605 missense possibly damaging 0.81
R7664:Prdm9 UTSW 17 15555571 missense probably damaging 0.99
R7755:Prdm9 UTSW 17 15544964 missense probably damaging 1.00
R7817:Prdm9 UTSW 17 15559049 missense probably damaging 1.00
R7875:Prdm9 UTSW 17 15553542 nonsense probably null
R7958:Prdm9 UTSW 17 15553542 nonsense probably null
X0021:Prdm9 UTSW 17 15553472 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTGTAGATACCTGGGAAGACC -3'
(R):5'- AAGGTGGGTCCCGATATGTGAG -3'

Sequencing Primer
(F):5'- GGAAGACCCTAACATAACATGGG -3'
(R):5'- TCTGTCAGCATGAACATCCAGTG -3'
Posted On2016-07-06