Incidental Mutation 'R5187:Vmn1r225'
ID397989
Institutional Source Beutler Lab
Gene Symbol Vmn1r225
Ensembl Gene ENSMUSG00000043537
Gene Namevomeronasal 1 receptor 225
SynonymsV1re5
MMRRC Submission 042766-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R5187 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location20502299-20503195 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 20502915 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Arginine at position 206 (T206R)
Ref Sequence ENSEMBL: ENSMUSP00000056068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061660]
Predicted Effect probably damaging
Transcript: ENSMUST00000061660
AA Change: T206R

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000056068
Gene: ENSMUSG00000043537
AA Change: T206R

DomainStartEndE-ValueType
Pfam:TAS2R 1 287 8.9e-15 PFAM
Pfam:V1R 11 291 3.1e-24 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,718,809 L620* probably null Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abcg5 A G 17: 84,658,564 L628S probably damaging Het
Acbd3 C T 1: 180,736,732 R201* probably null Het
Adsl A G 15: 80,948,905 probably benign Het
Asic1 GCACC GCACCACC 15: 99,698,803 probably benign Het
Cachd1 T C 4: 100,966,200 V483A possibly damaging Het
Calm1 T C 12: 100,200,213 S19P probably benign Het
Casq1 T C 1: 172,213,074 N313S possibly damaging Het
Cav2 G T 6: 17,286,936 A64S possibly damaging Het
Ccdc114 A G 7: 45,929,116 I77V probably damaging Het
Ccdc167 C A 17: 29,705,511 A39S possibly damaging Het
Cd274 T C 19: 29,382,536 L247P probably benign Het
Cdhr5 T C 7: 141,274,448 E138G probably damaging Het
Cltb C T 13: 54,593,880 C81Y probably benign Het
Clvs1 T C 4: 9,281,865 L103P possibly damaging Het
Cntrob G T 11: 69,321,891 Q106K possibly damaging Het
Ctsh T C 9: 90,054,590 L14P probably damaging Het
Cubn T C 2: 13,287,568 N3268S probably damaging Het
Cyb5r4 T C 9: 87,026,948 V26A possibly damaging Het
Ddx18 A G 1: 121,562,128 I184T probably damaging Het
Ddx60 T A 8: 61,974,188 W766R probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnah5 G A 15: 28,272,172 V1041I probably benign Het
Dnajc21 A T 15: 10,463,964 N38K probably benign Het
Ermap T C 4: 119,185,818 probably null Het
Fam129a T A 1: 151,703,829 L433Q possibly damaging Het
Fryl A G 5: 73,086,600 L1209P possibly damaging Het
Gm5093 T C 17: 46,439,873 E76G possibly damaging Het
Grk6 T C 13: 55,451,706 C169R probably damaging Het
Hmgn1 A T 16: 96,122,427 probably null Het
Lpcat2b T A 5: 107,434,135 Y443* probably null Het
Macf1 T A 4: 123,472,089 M1395L probably benign Het
Mllt10 C T 2: 18,208,774 Q997* probably null Het
Mocos T A 18: 24,692,554 V722E probably damaging Het
Moxd2 A T 6: 40,879,337 L534M probably benign Het
Mphosph10 T C 7: 64,385,820 M368V possibly damaging Het
Myo15 G A 11: 60,503,614 G2383D probably damaging Het
Myo5b T C 18: 74,701,674 I935T possibly damaging Het
Ndst4 T A 3: 125,437,911 L43H probably damaging Het
Nsl1 A G 1: 191,075,190 N189D probably benign Het
Olfr558 A T 7: 102,709,661 H134L probably damaging Het
Pcdh8 T C 14: 79,770,154 D323G probably damaging Het
Pkhd1 A G 1: 20,209,224 S2957P possibly damaging Het
Prdm9 T G 17: 15,562,893 E42D probably damaging Het
Rasal1 C A 5: 120,675,395 H611Q probably benign Het
Rif1 T A 2: 52,081,289 W260R probably damaging Het
Rpain A G 11: 70,973,832 D115G probably benign Het
Rpl3l T C 17: 24,732,455 V110A possibly damaging Het
Ryr2 T A 13: 11,772,452 I1012F probably damaging Het
Sema4f A G 6: 82,917,650 V480A probably benign Het
Slc35a3 T A 3: 116,681,145 K199N probably damaging Het
Slc5a6 T C 5: 31,042,978 Y121C probably damaging Het
Slc7a14 T C 3: 31,237,365 probably null Het
Sort1 T A 3: 108,324,676 I172N probably damaging Het
Spink5 C A 18: 43,989,451 H328N probably damaging Het
Tbl1xr1 A G 3: 22,209,606 D504G probably damaging Het
Tcaf3 C T 6: 42,597,020 C86Y possibly damaging Het
Tfap2e T C 4: 126,734,641 D174G probably benign Het
Tmem42 T C 9: 123,022,167 V65A probably damaging Het
Vmn2r38 A G 7: 9,097,572 F65S probably benign Het
Vmn2r87 A T 10: 130,497,339 L14Q probably null Het
Xirp2 T C 2: 67,515,367 S2651P probably benign Het
Zfp429 G A 13: 67,390,840 L162F probably damaging Het
Zhx1 A T 15: 58,052,423 M809K probably damaging Het
Other mutations in Vmn1r225
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01093:Vmn1r225 APN 17 20502819 missense probably damaging 1.00
IGL01830:Vmn1r225 APN 17 20502455 missense probably damaging 0.96
IGL02943:Vmn1r225 APN 17 20502305 missense possibly damaging 0.67
R0544:Vmn1r225 UTSW 17 20502456 missense probably benign 0.44
R1126:Vmn1r225 UTSW 17 20502326 missense probably benign 0.03
R1809:Vmn1r225 UTSW 17 20502656 missense probably benign 0.04
R1928:Vmn1r225 UTSW 17 20502809 missense probably benign 0.00
R2044:Vmn1r225 UTSW 17 20502590 missense possibly damaging 0.50
R2191:Vmn1r225 UTSW 17 20502885 missense probably damaging 0.98
R2206:Vmn1r225 UTSW 17 20502349 missense possibly damaging 0.56
R2207:Vmn1r225 UTSW 17 20502349 missense possibly damaging 0.56
R2680:Vmn1r225 UTSW 17 20502793 missense probably benign 0.00
R3740:Vmn1r225 UTSW 17 20502999 missense possibly damaging 0.56
R3807:Vmn1r225 UTSW 17 20502852 nonsense probably null
R4196:Vmn1r225 UTSW 17 20502975 missense probably benign 0.00
R4970:Vmn1r225 UTSW 17 20502569 missense possibly damaging 0.74
R5129:Vmn1r225 UTSW 17 20503116 missense probably damaging 1.00
R5130:Vmn1r225 UTSW 17 20502785 missense possibly damaging 0.81
R5580:Vmn1r225 UTSW 17 20502839 missense probably damaging 1.00
R6563:Vmn1r225 UTSW 17 20502501 missense probably benign 0.03
R6674:Vmn1r225 UTSW 17 20503115 missense probably benign 0.06
R7003:Vmn1r225 UTSW 17 20503154 missense probably null 0.01
R7143:Vmn1r225 UTSW 17 20502384 missense probably benign 0.22
R7422:Vmn1r225 UTSW 17 20502797 missense probably benign 0.25
R7651:Vmn1r225 UTSW 17 20502349 missense possibly damaging 0.56
Z1177:Vmn1r225 UTSW 17 20502491 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- AGGACTCTTGATTTTACTCTGCTG -3'
(R):5'- CACCAACTGGGGTTATGTGAAAG -3'

Sequencing Primer
(F):5'- GATTGTGTGCCTGCTAGTAAATAC -3'
(R):5'- GGGTTATGTGAAAGAGCAATATAACC -3'
Posted On2016-07-06