Incidental Mutation 'R5187:Myo5b'
ID 397997
Institutional Source Beutler Lab
Gene Symbol Myo5b
Ensembl Gene ENSMUSG00000025885
Gene Name myosin VB
Synonyms
MMRRC Submission 042766-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.734) question?
Stock # R5187 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 74575435-74905769 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 74834745 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 935 (I935T)
Ref Sequence ENSEMBL: ENSMUSP00000112728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074157] [ENSMUST00000121875]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000074157
AA Change: I935T

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000073790
Gene: ENSMUSG00000025885
AA Change: I935T

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1311 1415 N/A INTRINSIC
DIL 1650 1755 7.48e-51 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121875
AA Change: I935T

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112728
Gene: ENSMUSG00000025885
AA Change: I935T

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1332 1441 N/A INTRINSIC
DIL 1676 1781 7.48e-51 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with other proteins, may be involved in plasma membrane recycling. Mutations in this gene are associated with microvillous inclusion disease. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice show perinatal mortality, diarrhea, intestinal microvillus atrophy and the presence of microvillus inclusion bodies, resembling phenotype of Microvillus Inclusion Disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,376,349 (GRCm39) V173M probably damaging Het
Abcg5 A G 17: 84,965,992 (GRCm39) L628S probably damaging Het
Acbd3 C T 1: 180,564,297 (GRCm39) R201* probably null Het
Adsl A G 15: 80,833,106 (GRCm39) probably benign Het
Asic1 GCACC GCACCACC 15: 99,596,684 (GRCm39) probably benign Het
Cachd1 T C 4: 100,823,397 (GRCm39) V483A possibly damaging Het
Calm1 T C 12: 100,166,472 (GRCm39) S19P probably benign Het
Casq1 T C 1: 172,040,641 (GRCm39) N313S possibly damaging Het
Cav2 G T 6: 17,286,935 (GRCm39) A64S possibly damaging Het
Ccdc167 C A 17: 29,924,485 (GRCm39) A39S possibly damaging Het
Cd274 T C 19: 29,359,936 (GRCm39) L247P probably benign Het
Cdhr5 T C 7: 140,854,361 (GRCm39) E138G probably damaging Het
Cltb C T 13: 54,741,693 (GRCm39) C81Y probably benign Het
Clvs1 T C 4: 9,281,865 (GRCm39) L103P possibly damaging Het
Cntrob G T 11: 69,212,717 (GRCm39) Q106K possibly damaging Het
Ctsh T C 9: 89,936,643 (GRCm39) L14P probably damaging Het
Cubn T C 2: 13,292,379 (GRCm39) N3268S probably damaging Het
Cyb5r4 T C 9: 86,909,001 (GRCm39) V26A possibly damaging Het
Ddx18 A G 1: 121,489,857 (GRCm39) I184T probably damaging Het
Ddx60 T A 8: 62,427,222 (GRCm39) W766R probably damaging Het
Dnah2 C T 11: 69,349,746 (GRCm39) R2399Q probably benign Het
Dnah5 G A 15: 28,272,318 (GRCm39) V1041I probably benign Het
Dnajc21 A T 15: 10,464,050 (GRCm39) N38K probably benign Het
Ermap T C 4: 119,043,015 (GRCm39) probably null Het
Fryl A G 5: 73,243,943 (GRCm39) L1209P possibly damaging Het
Gm5093 T C 17: 46,750,799 (GRCm39) E76G possibly damaging Het
Grk6 T C 13: 55,599,519 (GRCm39) C169R probably damaging Het
Hmgn1 A T 16: 95,923,627 (GRCm39) probably null Het
Lpcat2b T A 5: 107,582,001 (GRCm39) Y443* probably null Het
Macf1 T A 4: 123,365,882 (GRCm39) M1395L probably benign Het
Mllt10 C T 2: 18,213,585 (GRCm39) Q997* probably null Het
Mocos T A 18: 24,825,611 (GRCm39) V722E probably damaging Het
Moxd2 A T 6: 40,856,271 (GRCm39) L534M probably benign Het
Mphosph10 T C 7: 64,035,568 (GRCm39) M368V possibly damaging Het
Myo15a G A 11: 60,394,440 (GRCm39) G2383D probably damaging Het
Ndst4 T A 3: 125,231,560 (GRCm39) L43H probably damaging Het
Niban1 T A 1: 151,579,580 (GRCm39) L433Q possibly damaging Het
Nsl1 A G 1: 190,807,387 (GRCm39) N189D probably benign Het
Odad1 A G 7: 45,578,540 (GRCm39) I77V probably damaging Het
Or51e1 A T 7: 102,358,868 (GRCm39) H134L probably damaging Het
Pcdh8 T C 14: 80,007,594 (GRCm39) D323G probably damaging Het
Pkhd1 A G 1: 20,279,448 (GRCm39) S2957P possibly damaging Het
Prdm9 T G 17: 15,783,155 (GRCm39) E42D probably damaging Het
Rasal1 C A 5: 120,813,460 (GRCm39) H611Q probably benign Het
Relch T A 1: 105,646,534 (GRCm39) L620* probably null Het
Rif1 T A 2: 51,971,301 (GRCm39) W260R probably damaging Het
Rpain A G 11: 70,864,658 (GRCm39) D115G probably benign Het
Rpl3l T C 17: 24,951,429 (GRCm39) V110A possibly damaging Het
Ryr2 T A 13: 11,787,338 (GRCm39) I1012F probably damaging Het
Sema4f A G 6: 82,894,631 (GRCm39) V480A probably benign Het
Slc35a3 T A 3: 116,474,794 (GRCm39) K199N probably damaging Het
Slc5a6 T C 5: 31,200,322 (GRCm39) Y121C probably damaging Het
Slc7a14 T C 3: 31,291,514 (GRCm39) probably null Het
Sort1 T A 3: 108,231,992 (GRCm39) I172N probably damaging Het
Spink5 C A 18: 44,122,518 (GRCm39) H328N probably damaging Het
Tbl1xr1 A G 3: 22,263,770 (GRCm39) D504G probably damaging Het
Tcaf3 C T 6: 42,573,954 (GRCm39) C86Y possibly damaging Het
Tfap2e T C 4: 126,628,434 (GRCm39) D174G probably benign Het
Tmem42 T C 9: 122,851,232 (GRCm39) V65A probably damaging Het
Vmn1r225 C G 17: 20,723,177 (GRCm39) T206R probably damaging Het
Vmn2r38 A G 7: 9,100,571 (GRCm39) F65S probably benign Het
Vmn2r87 A T 10: 130,333,208 (GRCm39) L14Q probably null Het
Xirp2 T C 2: 67,345,711 (GRCm39) S2651P probably benign Het
Zfp429 G A 13: 67,538,959 (GRCm39) L162F probably damaging Het
Zhx1 A T 15: 57,915,819 (GRCm39) M809K probably damaging Het
Other mutations in Myo5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Myo5b APN 18 74,787,147 (GRCm39) splice site probably benign
IGL01083:Myo5b APN 18 74,866,974 (GRCm39) splice site probably benign
IGL01448:Myo5b APN 18 74,777,161 (GRCm39) missense probably damaging 0.97
IGL01516:Myo5b APN 18 74,760,266 (GRCm39) missense probably damaging 0.99
IGL01525:Myo5b APN 18 74,873,620 (GRCm39) missense probably damaging 1.00
IGL01873:Myo5b APN 18 74,713,467 (GRCm39) missense probably damaging 1.00
IGL01887:Myo5b APN 18 74,848,007 (GRCm39) missense probably benign 0.41
IGL01953:Myo5b APN 18 74,702,838 (GRCm39) missense possibly damaging 0.62
IGL01976:Myo5b APN 18 74,831,348 (GRCm39) missense probably damaging 1.00
IGL02017:Myo5b APN 18 74,850,070 (GRCm39) missense probably damaging 1.00
IGL02331:Myo5b APN 18 74,771,111 (GRCm39) critical splice acceptor site probably null
IGL02624:Myo5b APN 18 74,848,010 (GRCm39) missense probably damaging 0.98
IGL02707:Myo5b APN 18 74,828,438 (GRCm39) splice site probably benign
IGL02806:Myo5b APN 18 74,750,151 (GRCm39) critical splice donor site probably null
IGL03009:Myo5b APN 18 74,894,039 (GRCm39) missense possibly damaging 0.54
IGL03061:Myo5b APN 18 74,713,615 (GRCm39) splice site probably benign
IGL03061:Myo5b APN 18 74,767,630 (GRCm39) missense probably benign 0.02
unrat UTSW 18 74,786,432 (GRCm39) missense possibly damaging 0.93
BB007:Myo5b UTSW 18 74,864,825 (GRCm39) missense probably benign
BB017:Myo5b UTSW 18 74,864,825 (GRCm39) missense probably benign
R0085:Myo5b UTSW 18 74,834,751 (GRCm39) missense probably benign 0.21
R0114:Myo5b UTSW 18 74,875,242 (GRCm39) missense probably benign 0.03
R0226:Myo5b UTSW 18 74,875,251 (GRCm39) missense probably benign
R0242:Myo5b UTSW 18 74,794,787 (GRCm39) missense possibly damaging 0.95
R0242:Myo5b UTSW 18 74,794,787 (GRCm39) missense possibly damaging 0.95
R0471:Myo5b UTSW 18 74,862,025 (GRCm39) splice site probably benign
R0494:Myo5b UTSW 18 74,787,038 (GRCm39) missense probably damaging 1.00
R0920:Myo5b UTSW 18 74,758,712 (GRCm39) missense probably benign 0.09
R1144:Myo5b UTSW 18 74,758,658 (GRCm39) missense probably damaging 1.00
R1177:Myo5b UTSW 18 74,777,143 (GRCm39) missense probably damaging 1.00
R1387:Myo5b UTSW 18 74,777,272 (GRCm39) splice site probably benign
R1468:Myo5b UTSW 18 74,873,574 (GRCm39) missense probably damaging 0.99
R1468:Myo5b UTSW 18 74,873,574 (GRCm39) missense probably damaging 0.99
R1555:Myo5b UTSW 18 74,702,853 (GRCm39) missense probably damaging 1.00
R1587:Myo5b UTSW 18 74,867,061 (GRCm39) missense probably benign
R1600:Myo5b UTSW 18 74,846,611 (GRCm39) unclassified probably benign
R1639:Myo5b UTSW 18 74,840,987 (GRCm39) missense probably benign 0.19
R1779:Myo5b UTSW 18 74,875,218 (GRCm39) missense probably benign 0.06
R1806:Myo5b UTSW 18 74,710,680 (GRCm39) missense possibly damaging 0.91
R1929:Myo5b UTSW 18 74,866,996 (GRCm39) missense probably damaging 0.99
R2046:Myo5b UTSW 18 74,710,526 (GRCm39) missense probably benign 0.28
R2093:Myo5b UTSW 18 74,892,263 (GRCm39) missense probably damaging 0.98
R2270:Myo5b UTSW 18 74,866,996 (GRCm39) missense probably damaging 0.99
R2272:Myo5b UTSW 18 74,866,996 (GRCm39) missense probably damaging 0.99
R2298:Myo5b UTSW 18 74,758,676 (GRCm39) missense probably damaging 1.00
R2433:Myo5b UTSW 18 74,892,158 (GRCm39) missense probably damaging 1.00
R2888:Myo5b UTSW 18 74,895,689 (GRCm39) missense probably damaging 1.00
R3824:Myo5b UTSW 18 74,794,726 (GRCm39) missense probably benign 0.41
R3937:Myo5b UTSW 18 74,849,108 (GRCm39) missense probably damaging 0.98
R3938:Myo5b UTSW 18 74,849,108 (GRCm39) missense probably damaging 0.98
R3947:Myo5b UTSW 18 74,828,474 (GRCm39) missense probably damaging 1.00
R3971:Myo5b UTSW 18 74,873,598 (GRCm39) missense probably damaging 1.00
R3972:Myo5b UTSW 18 74,873,598 (GRCm39) missense probably damaging 1.00
R3974:Myo5b UTSW 18 74,767,552 (GRCm39) missense probably damaging 1.00
R4027:Myo5b UTSW 18 74,892,311 (GRCm39) missense possibly damaging 0.67
R4080:Myo5b UTSW 18 74,873,559 (GRCm39) missense probably benign
R4285:Myo5b UTSW 18 74,847,920 (GRCm39) missense probably benign
R4308:Myo5b UTSW 18 74,864,811 (GRCm39) missense possibly damaging 0.89
R4411:Myo5b UTSW 18 74,831,345 (GRCm39) missense possibly damaging 0.89
R4415:Myo5b UTSW 18 74,713,479 (GRCm39) missense probably damaging 1.00
R4516:Myo5b UTSW 18 74,758,745 (GRCm39) missense probably damaging 1.00
R4690:Myo5b UTSW 18 74,855,533 (GRCm39) missense probably damaging 0.97
R4781:Myo5b UTSW 18 74,877,752 (GRCm39) missense possibly damaging 0.80
R4786:Myo5b UTSW 18 74,828,451 (GRCm39) missense probably benign 0.01
R4796:Myo5b UTSW 18 74,877,701 (GRCm39) missense possibly damaging 0.68
R4924:Myo5b UTSW 18 74,828,455 (GRCm39) missense probably benign 0.19
R4972:Myo5b UTSW 18 74,760,264 (GRCm39) missense probably damaging 0.98
R5004:Myo5b UTSW 18 74,877,844 (GRCm39) critical splice donor site probably null
R5024:Myo5b UTSW 18 74,849,105 (GRCm39) missense possibly damaging 0.90
R5043:Myo5b UTSW 18 74,771,224 (GRCm39) critical splice donor site probably null
R5232:Myo5b UTSW 18 74,848,003 (GRCm39) missense probably damaging 0.99
R5254:Myo5b UTSW 18 74,833,677 (GRCm39) missense possibly damaging 0.65
R5255:Myo5b UTSW 18 74,795,741 (GRCm39) missense possibly damaging 0.94
R5715:Myo5b UTSW 18 74,875,246 (GRCm39) missense possibly damaging 0.88
R5733:Myo5b UTSW 18 74,787,128 (GRCm39) missense possibly damaging 0.93
R5797:Myo5b UTSW 18 74,834,592 (GRCm39) missense probably benign
R5875:Myo5b UTSW 18 74,840,973 (GRCm39) splice site probably null
R6088:Myo5b UTSW 18 74,853,969 (GRCm39) missense possibly damaging 0.89
R6104:Myo5b UTSW 18 74,833,750 (GRCm39) missense probably benign 0.19
R6237:Myo5b UTSW 18 74,875,249 (GRCm39) missense probably damaging 1.00
R6265:Myo5b UTSW 18 74,710,511 (GRCm39) splice site probably null
R6267:Myo5b UTSW 18 74,750,062 (GRCm39) missense probably damaging 1.00
R6328:Myo5b UTSW 18 74,750,064 (GRCm39) missense probably damaging 1.00
R6330:Myo5b UTSW 18 74,750,064 (GRCm39) missense probably damaging 1.00
R6331:Myo5b UTSW 18 74,750,064 (GRCm39) missense probably damaging 1.00
R6347:Myo5b UTSW 18 74,903,456 (GRCm39) missense probably benign 0.11
R6479:Myo5b UTSW 18 74,750,086 (GRCm39) missense probably damaging 1.00
R6748:Myo5b UTSW 18 74,834,574 (GRCm39) missense possibly damaging 0.80
R6749:Myo5b UTSW 18 74,834,574 (GRCm39) missense possibly damaging 0.80
R6750:Myo5b UTSW 18 74,750,106 (GRCm39) missense possibly damaging 0.74
R6833:Myo5b UTSW 18 74,903,396 (GRCm39) missense probably benign
R6876:Myo5b UTSW 18 74,841,026 (GRCm39) missense probably benign
R6880:Myo5b UTSW 18 74,855,501 (GRCm39) missense probably benign 0.02
R6902:Myo5b UTSW 18 74,809,756 (GRCm39) missense possibly damaging 0.95
R6985:Myo5b UTSW 18 74,786,432 (GRCm39) missense possibly damaging 0.93
R7039:Myo5b UTSW 18 74,834,599 (GRCm39) missense probably benign 0.01
R7162:Myo5b UTSW 18 74,828,498 (GRCm39) missense probably benign 0.02
R7345:Myo5b UTSW 18 74,841,095 (GRCm39) missense possibly damaging 0.82
R7530:Myo5b UTSW 18 74,864,802 (GRCm39) missense probably benign 0.00
R7564:Myo5b UTSW 18 74,767,582 (GRCm39) missense possibly damaging 0.84
R7629:Myo5b UTSW 18 74,760,325 (GRCm39) critical splice donor site probably null
R7635:Myo5b UTSW 18 74,713,467 (GRCm39) missense probably damaging 1.00
R7670:Myo5b UTSW 18 74,834,517 (GRCm39) missense probably benign 0.05
R7754:Myo5b UTSW 18 74,767,630 (GRCm39) missense probably benign 0.02
R7930:Myo5b UTSW 18 74,864,825 (GRCm39) missense probably benign
R8013:Myo5b UTSW 18 74,893,970 (GRCm39) nonsense probably null
R8271:Myo5b UTSW 18 74,760,261 (GRCm39) missense probably damaging 1.00
R8312:Myo5b UTSW 18 74,867,033 (GRCm39) missense probably damaging 1.00
R8383:Myo5b UTSW 18 74,777,049 (GRCm39) missense probably benign 0.05
R8384:Myo5b UTSW 18 74,875,273 (GRCm39) missense probably damaging 1.00
R8474:Myo5b UTSW 18 74,903,411 (GRCm39) missense probably damaging 1.00
R8825:Myo5b UTSW 18 74,892,169 (GRCm39) missense possibly damaging 0.79
R8846:Myo5b UTSW 18 74,841,043 (GRCm39) missense probably benign 0.04
R9236:Myo5b UTSW 18 74,853,934 (GRCm39) missense probably benign
R9283:Myo5b UTSW 18 74,777,149 (GRCm39) missense probably benign 0.16
R9370:Myo5b UTSW 18 74,760,246 (GRCm39) missense possibly damaging 0.54
R9506:Myo5b UTSW 18 74,877,831 (GRCm39) missense possibly damaging 0.82
R9523:Myo5b UTSW 18 74,861,968 (GRCm39) missense possibly damaging 0.89
R9622:Myo5b UTSW 18 74,848,017 (GRCm39) missense probably damaging 0.99
R9676:Myo5b UTSW 18 74,892,231 (GRCm39) missense probably benign 0.22
R9725:Myo5b UTSW 18 74,856,841 (GRCm39) missense probably benign
RF009:Myo5b UTSW 18 74,777,070 (GRCm39) missense probably damaging 1.00
Z1088:Myo5b UTSW 18 74,877,820 (GRCm39) missense probably benign 0.35
Z1177:Myo5b UTSW 18 74,750,088 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ATGGCACGGAAGCGTTTTC -3'
(R):5'- TTATCTGTAGCTCCCAAAGGTGG -3'

Sequencing Primer
(F):5'- CACGGAAGCGTTTTCTGCGG -3'
(R):5'- TGAGCACGCTATGATCCCATG -3'
Posted On 2016-07-06