Incidental Mutation 'R5188:Olfr353'
ID398003
Institutional Source Beutler Lab
Gene Symbol Olfr353
Ensembl Gene ENSMUSG00000075382
Gene Nameolfactory receptor 353
SynonymsGA_x6K02T2NLDC-33585366-33584431, MOR127-3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R5188 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location36887293-36892936 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36890393 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 152 (I152L)
Ref Sequence ENSEMBL: ENSMUSP00000149378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100149] [ENSMUST00000215925] [ENSMUST00000217215]
Predicted Effect probably benign
Transcript: ENSMUST00000100149
AA Change: I152L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097726
Gene: ENSMUSG00000075382
AA Change: I152L

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.3e-56 PFAM
Pfam:7tm_1 39 288 3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215925
AA Change: I152L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000217215
AA Change: I152L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca12 T A 1: 71,291,492 I1335F probably benign Het
Amigo3 C A 9: 108,054,683 A435E probably damaging Het
Atr T A 9: 95,921,725 N1871K probably benign Het
Ctsw C T 19: 5,467,092 A71T probably damaging Het
Decr1 C T 4: 15,924,270 V217M probably damaging Het
Golgb1 A G 16: 36,918,465 T2389A probably benign Het
Gpr151 A G 18: 42,578,755 M286T probably benign Het
Katnbl1 T A 2: 112,410,154 I262N probably damaging Het
Lrp1 A G 10: 127,607,952 C149R probably damaging Het
Mpc1 A T 17: 8,296,383 probably benign Het
Ndufv1 A T 19: 4,009,988 N37K probably damaging Het
Olfr1046 T G 2: 86,217,177 S178R probably benign Het
Olfr150 T C 9: 39,737,235 V140A probably benign Het
Olfr313 C A 11: 58,817,320 T104K probably damaging Het
Pnpla7 C A 2: 24,997,300 P52Q probably benign Het
Prh1 A G 6: 132,571,707 Q59R unknown Het
Ren1 A G 1: 133,350,613 probably benign Het
Rnf148 T C 6: 23,654,140 T286A probably damaging Het
Sdk1 T C 5: 141,956,260 probably null Het
Srp72 T A 5: 76,974,751 S10T possibly damaging Het
Stk11 G T 10: 80,126,279 G215V probably damaging Het
Stk4 T C 2: 164,088,908 M143T possibly damaging Het
Supt20 T A 3: 54,710,428 S318T possibly damaging Het
Tchh G C 3: 93,446,679 R1142P unknown Het
Vipas39 G T 12: 87,254,247 R161S probably benign Het
Other mutations in Olfr353
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02706:Olfr353 APN 2 36890719 missense probably damaging 1.00
IGL02944:Olfr353 APN 2 36890788 missense possibly damaging 0.83
R0101:Olfr353 UTSW 2 36890126 missense probably damaging 1.00
R0118:Olfr353 UTSW 2 36890023 missense probably benign 0.07
R0276:Olfr353 UTSW 2 36890023 missense probably benign 0.26
R0944:Olfr353 UTSW 2 36890686 missense probably damaging 1.00
R0975:Olfr353 UTSW 2 36890550 missense possibly damaging 0.52
R1895:Olfr353 UTSW 2 36890446 missense possibly damaging 0.92
R1946:Olfr353 UTSW 2 36890446 missense possibly damaging 0.92
R2847:Olfr353 UTSW 2 36890524 missense probably damaging 1.00
R4573:Olfr353 UTSW 2 36890190 missense probably damaging 1.00
R4631:Olfr353 UTSW 2 36890618 missense probably benign 0.01
R4647:Olfr353 UTSW 2 36890651 missense probably benign 0.00
R4918:Olfr353 UTSW 2 36890332 missense probably damaging 0.98
R4967:Olfr353 UTSW 2 36890707 missense probably damaging 1.00
R5102:Olfr353 UTSW 2 36890044 missense possibly damaging 0.87
R5392:Olfr353 UTSW 2 36890674 missense probably benign 0.34
R5608:Olfr353 UTSW 2 36890515 missense probably damaging 1.00
R6527:Olfr353 UTSW 2 36890582 missense probably benign 0.02
X0017:Olfr353 UTSW 2 36889987 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTGGACCCTAAGGACAG -3'
(R):5'- CTGGTTGTCTCACACAGATGTAC -3'

Sequencing Primer
(F):5'- CCTAAGGACAGCAAATACTATGCGG -3'
(R):5'- GTTGTCTCACACAGATGTACTTATTC -3'
Posted On2016-07-06