Incidental Mutation 'R5188:Olfr1046'
ID398004
Institutional Source Beutler Lab
Gene Symbol Olfr1046
Ensembl Gene ENSMUSG00000075197
Gene Nameolfactory receptor 1046
SynonymsGA_x6K02T2Q125-47692494-47691544, MOR194-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R5188 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86214987-86219314 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 86217177 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 178 (S178R)
Ref Sequence ENSEMBL: ENSMUSP00000148873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099902] [ENSMUST00000213987]
Predicted Effect probably benign
Transcript: ENSMUST00000099902
AA Change: S178R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097486
Gene: ENSMUSG00000075197
AA Change: S178R

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 2.2e-50 PFAM
Pfam:7tm_1 44 293 4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213987
AA Change: S178R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca12 T A 1: 71,291,492 I1335F probably benign Het
Amigo3 C A 9: 108,054,683 A435E probably damaging Het
Atr T A 9: 95,921,725 N1871K probably benign Het
Ctsw C T 19: 5,467,092 A71T probably damaging Het
Decr1 C T 4: 15,924,270 V217M probably damaging Het
Golgb1 A G 16: 36,918,465 T2389A probably benign Het
Gpr151 A G 18: 42,578,755 M286T probably benign Het
Katnbl1 T A 2: 112,410,154 I262N probably damaging Het
Lrp1 A G 10: 127,607,952 C149R probably damaging Het
Mpc1 A T 17: 8,296,383 probably benign Het
Ndufv1 A T 19: 4,009,988 N37K probably damaging Het
Olfr150 T C 9: 39,737,235 V140A probably benign Het
Olfr313 C A 11: 58,817,320 T104K probably damaging Het
Olfr353 T A 2: 36,890,393 I152L probably benign Het
Pnpla7 C A 2: 24,997,300 P52Q probably benign Het
Prh1 A G 6: 132,571,707 Q59R unknown Het
Ren1 A G 1: 133,350,613 probably benign Het
Rnf148 T C 6: 23,654,140 T286A probably damaging Het
Sdk1 T C 5: 141,956,260 probably null Het
Srp72 T A 5: 76,974,751 S10T possibly damaging Het
Stk11 G T 10: 80,126,279 G215V probably damaging Het
Stk4 T C 2: 164,088,908 M143T possibly damaging Het
Supt20 T A 3: 54,710,428 S318T possibly damaging Het
Tchh G C 3: 93,446,679 R1142P unknown Het
Vipas39 G T 12: 87,254,247 R161S probably benign Het
Other mutations in Olfr1046
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Olfr1046 APN 2 86217572 missense probably damaging 1.00
IGL01613:Olfr1046 APN 2 86217161 missense probably damaging 1.00
IGL03327:Olfr1046 APN 2 86217274 nonsense probably null
R0183:Olfr1046 UTSW 2 86216829 missense probably damaging 1.00
R1738:Olfr1046 UTSW 2 86217716 unclassified probably null
R2279:Olfr1046 UTSW 2 86216804 missense probably benign
R4677:Olfr1046 UTSW 2 86217688 missense probably benign 0.04
R4828:Olfr1046 UTSW 2 86217533 missense possibly damaging 0.62
R6244:Olfr1046 UTSW 2 86217222 missense possibly damaging 0.93
R8097:Olfr1046 UTSW 2 86217666 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTACTGTCAGATGAGAGCTGC -3'
(R):5'- AACTGTTTATCCTCTCAGCCATGG -3'

Sequencing Primer
(F):5'- TGGAGAAGGCTTTGGACCTCC -3'
(R):5'- CCATGGCTTATGACCGCTATGTAG -3'
Posted On2016-07-06