Incidental Mutation 'R5188:Katnbl1'
ID398005
Institutional Source Beutler Lab
Gene Symbol Katnbl1
Ensembl Gene ENSMUSG00000027132
Gene Namekatanin p80 subunit B like 1
Synonyms2410042D21Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.785) question?
Stock #R5188 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location112379211-112414240 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 112410154 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 262 (I262N)
Ref Sequence ENSEMBL: ENSMUSP00000028552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028552] [ENSMUST00000141047]
Predicted Effect probably damaging
Transcript: ENSMUST00000028552
AA Change: I262N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028552
Gene: ENSMUSG00000027132
AA Change: I262N

DomainStartEndE-ValueType
Pfam:Katanin_con80 144 295 1.1e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141047
SMART Domains Protein: ENSMUSP00000124314
Gene: ENSMUSG00000096764

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
SCOP:d1qqea_ 99 156 8e-3 SMART
Pfam:AA_permease 175 369 6.6e-25 PFAM
Pfam:AA_permease 438 746 3.6e-43 PFAM
Pfam:SLC12 758 884 6.8e-20 PFAM
Pfam:SLC12 877 1033 5.9e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151257
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca12 T A 1: 71,291,492 I1335F probably benign Het
Amigo3 C A 9: 108,054,683 A435E probably damaging Het
Atr T A 9: 95,921,725 N1871K probably benign Het
Ctsw C T 19: 5,467,092 A71T probably damaging Het
Decr1 C T 4: 15,924,270 V217M probably damaging Het
Golgb1 A G 16: 36,918,465 T2389A probably benign Het
Gpr151 A G 18: 42,578,755 M286T probably benign Het
Lrp1 A G 10: 127,607,952 C149R probably damaging Het
Mpc1 A T 17: 8,296,383 probably benign Het
Ndufv1 A T 19: 4,009,988 N37K probably damaging Het
Olfr1046 T G 2: 86,217,177 S178R probably benign Het
Olfr150 T C 9: 39,737,235 V140A probably benign Het
Olfr313 C A 11: 58,817,320 T104K probably damaging Het
Olfr353 T A 2: 36,890,393 I152L probably benign Het
Pnpla7 C A 2: 24,997,300 P52Q probably benign Het
Prh1 A G 6: 132,571,707 Q59R unknown Het
Ren1 A G 1: 133,350,613 probably benign Het
Rnf148 T C 6: 23,654,140 T286A probably damaging Het
Sdk1 T C 5: 141,956,260 probably null Het
Srp72 T A 5: 76,974,751 S10T possibly damaging Het
Stk11 G T 10: 80,126,279 G215V probably damaging Het
Stk4 T C 2: 164,088,908 M143T possibly damaging Het
Supt20 T A 3: 54,710,428 S318T possibly damaging Het
Tchh G C 3: 93,446,679 R1142P unknown Het
Vipas39 G T 12: 87,254,247 R161S probably benign Het
Other mutations in Katnbl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03155:Katnbl1 APN 2 112409232 critical splice donor site probably null
R0053:Katnbl1 UTSW 2 112404241 missense probably benign 0.29
R0053:Katnbl1 UTSW 2 112404241 missense probably benign 0.29
R1676:Katnbl1 UTSW 2 112406109 missense probably damaging 1.00
R1917:Katnbl1 UTSW 2 112409179 missense probably benign 0.36
R2990:Katnbl1 UTSW 2 112404240 missense probably damaging 1.00
R2993:Katnbl1 UTSW 2 112408618 splice site probably null
R7613:Katnbl1 UTSW 2 112409193 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCCAAGAAAGTTGTCCACTTG -3'
(R):5'- ATCCCAACTAGCAATGTGCC -3'

Sequencing Primer
(F):5'- AAGTTGTCCACTTGCTACAAATGCC -3'
(R):5'- GTGCCTTTTTCCTGTAAGAGATAAGC -3'
Posted On2016-07-06