Incidental Mutation 'R5188:Decr1'
ID398009
Institutional Source Beutler Lab
Gene Symbol Decr1
Ensembl Gene ENSMUSG00000028223
Gene Name2,4-dienoyl CoA reductase 1, mitochondrial
SynonymsNadph, 1200012F07Rik, Decr
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.776) question?
Stock #R5188 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location15917240-15945507 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 15924270 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 217 (V217M)
Ref Sequence ENSEMBL: ENSMUSP00000029877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029877]
Predicted Effect probably damaging
Transcript: ENSMUST00000029877
AA Change: V217M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029877
Gene: ENSMUSG00000028223
AA Change: V217M

DomainStartEndE-ValueType
Pfam:adh_short 60 253 7.7e-34 PFAM
Pfam:KR 61 182 4.3e-9 PFAM
Pfam:adh_short_C2 66 304 2e-27 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an accessory enzyme which participates in the beta-oxidation and metabolism of unsaturated fatty enoyl-CoA esters. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased sensitivity to fasting and cold stresses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca12 T A 1: 71,291,492 I1335F probably benign Het
Amigo3 C A 9: 108,054,683 A435E probably damaging Het
Atr T A 9: 95,921,725 N1871K probably benign Het
Ctsw C T 19: 5,467,092 A71T probably damaging Het
Golgb1 A G 16: 36,918,465 T2389A probably benign Het
Gpr151 A G 18: 42,578,755 M286T probably benign Het
Katnbl1 T A 2: 112,410,154 I262N probably damaging Het
Lrp1 A G 10: 127,607,952 C149R probably damaging Het
Mpc1 A T 17: 8,296,383 probably benign Het
Ndufv1 A T 19: 4,009,988 N37K probably damaging Het
Olfr1046 T G 2: 86,217,177 S178R probably benign Het
Olfr150 T C 9: 39,737,235 V140A probably benign Het
Olfr313 C A 11: 58,817,320 T104K probably damaging Het
Olfr353 T A 2: 36,890,393 I152L probably benign Het
Pnpla7 C A 2: 24,997,300 P52Q probably benign Het
Prh1 A G 6: 132,571,707 Q59R unknown Het
Ren1 A G 1: 133,350,613 probably benign Het
Rnf148 T C 6: 23,654,140 T286A probably damaging Het
Sdk1 T C 5: 141,956,260 probably null Het
Srp72 T A 5: 76,974,751 S10T possibly damaging Het
Stk11 G T 10: 80,126,279 G215V probably damaging Het
Stk4 T C 2: 164,088,908 M143T possibly damaging Het
Supt20 T A 3: 54,710,428 S318T possibly damaging Het
Tchh G C 3: 93,446,679 R1142P unknown Het
Vipas39 G T 12: 87,254,247 R161S probably benign Het
Other mutations in Decr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Decr1 APN 4 15933056 missense probably benign 0.23
IGL02736:Decr1 APN 4 15930952 missense probably benign 0.01
IGL03141:Decr1 APN 4 15932902 missense probably damaging 1.00
I1329:Decr1 UTSW 4 15930976 nonsense probably null
R0472:Decr1 UTSW 4 15919849 missense probably damaging 1.00
R1295:Decr1 UTSW 4 15919207 missense possibly damaging 0.93
R1898:Decr1 UTSW 4 15929801 missense probably damaging 1.00
R1955:Decr1 UTSW 4 15924256 missense probably benign 0.09
R3160:Decr1 UTSW 4 15930972 missense probably damaging 0.99
R3162:Decr1 UTSW 4 15930972 missense probably damaging 0.99
R3162:Decr1 UTSW 4 15930972 missense probably damaging 0.99
R4545:Decr1 UTSW 4 15930979 missense probably damaging 1.00
R4962:Decr1 UTSW 4 15930976 nonsense probably null
R5190:Decr1 UTSW 4 15924270 missense probably damaging 1.00
R5215:Decr1 UTSW 4 15929795 missense probably damaging 1.00
R5556:Decr1 UTSW 4 15919244 missense probably damaging 1.00
R6164:Decr1 UTSW 4 15924347 missense probably benign 0.32
R6253:Decr1 UTSW 4 15931179 missense probably benign 0.00
R6313:Decr1 UTSW 4 15924261 missense probably benign 0.00
R6830:Decr1 UTSW 4 15924355 critical splice acceptor site probably null
R6998:Decr1 UTSW 4 15930960 missense probably damaging 1.00
R7064:Decr1 UTSW 4 15945392
R8052:Decr1 UTSW 4 15933019 missense probably benign 0.00
X0026:Decr1 UTSW 4 15919846 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGTAAAATGTTCCCTCCTAAGAG -3'
(R):5'- TTTACTCGGGACCTCATTTGTG -3'

Sequencing Primer
(F):5'- GACCTTAAAATACGGGTAATTTTGC -3'
(R):5'- GGACCTCATTTGTGCCTGTCATG -3'
Posted On2016-07-06